National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 17042R-4 
 Symbol CG17042  Full Name CG17042 
 CG No CG17042  Old CG No CG17042 
 Synonyms CG17042 
 Accession No (Link to NCBI) NM_137017.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCGAAAGTTGTCAGCCATTGC 
 Primer Seq. 3'
aatctagaggtaccTCCACGTGTAGGTGGTGTTCA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GCGAAAGTTG TCAGCCATTG CCGAAATACC GAAAATCCTG TGCTCCACTT TGGCCACCGT 
0061 GTCGCAGAAT TTTGGCCGAA TGAGTGAATC GGAGGTGGAT GAGGATGACG TCGGNGAGGA 
0121 GGAGGCCTAT GTGCAGCGGA AGTTCTCCTA CGACGAGGAT GCCCTTGACT TTGAGCTGAG 
0181 GAACGGGGAA CAGGCAGGTG ACACTGACAG TGATGAGGAA GATTTGGTGT TGGTTCGGGA 
0241 GGAGGATGCT GAGGACGTGG ATGTACCGAA AGGTGCCAAG CAATCAAAGC TGCTGAAGGA 
0301 TGTCACGCCG GAATCGGATT ATGCATCGGA AGCCAATTAT CCGGCAAATG AGGCGAGCGA 
0361 TGACACGGAA TCCGACGATG AGGATGAGCC GGGCAGCACG GTATATTTCA TGAAACTGCC 
0421 ANGCgNNCGC CGCCGAGGAT ACGTATTCTT CTACGGAGGA CGAGGATGAC AGCGATTTCC 
0481 TGAACACCAC CTACACGTGG A 
 in silico PCR Fragment
0001 GCGAAAGTTG TCAGCCATTG CCGAAATACC GAAAATCCTG TGCTCCACTT TGGCCACCGT 
0061 GTCGCAGAAT TTTGGCCGAA TGAGTGAATC GGAGGTGGAT GAGGATGACG TCGGGGAGGA 
0121 GGAGGCCTAT GTGCAGCGGA AGTTCTCCTA CGACGAGGAT GCCCTTGACT TTGAGCTGAG 
0181 GAACGGGGAA CAGGCAGGTG ACACTGACAG TGATGAGGAA GATTTGGTGT TGGTTCGGGA 
0241 GGAGGATGCT GAGGACGTGG ATGTACCGAA AGGTGCCAAG CAATCAAAGC TGCTGAAGGA 
0301 TGTCACGCCG GAATCGGATT ATGCATCGGA AGCCAATTAT CCGGCAAATG AGGCGAGCGA 
0361 TGACACGGAA TCCGACGATG AGGATGAGCC GGGCAGCACG GTATATTTCA TGAAACTGCC 
0421 A-GCGGCCGC CGCCGAGGAT ACGTATTCTT CTACGGAGGA CGAGGATGAC AGCGATTTCC 
0481 TGAACACCAC CTACACGTGG A 
 Assemble Data

17042R-4.IR_full       1   GCGAAAGTTGTCAGCCATTGCCGAAATACCGAAAATCCTGTGCTCCACTTTGGCCACCGT 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17042R-4.in silico     1   GCGAAAGTTGTCAGCCATTGCCGAAATACCGAAAATCCTGTGCTCCACTTTGGCCACCGT 60


17042R-4.IR_full       61  GTCGCAGAATTTTGGCCGAATGAGTGAATCGGAGGTGGATGAGGATGACGTCGGNGAGGA 120
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
17042R-4.in silico     61  GTCGCAGAATTTTGGCCGAATGAGTGAATCGGAGGTGGATGAGGATGACGTCGGGGAGGA 120


17042R-4.IR_full       121 GGAGGCCTATGTGCAGCGGAAGTTCTCCTACGACGAGGATGCCCTTGACTTTGAGCTGAG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17042R-4.in silico     121 GGAGGCCTATGTGCAGCGGAAGTTCTCCTACGACGAGGATGCCCTTGACTTTGAGCTGAG 180


17042R-4.IR_full       181 GAACGGGGAACAGGCAGGTGACACTGACAGTGATGAGGAAGATTTGGTGTTGGTTCGGGA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17042R-4.in silico     181 GAACGGGGAACAGGCAGGTGACACTGACAGTGATGAGGAAGATTTGGTGTTGGTTCGGGA 240


17042R-4.IR_full       241 GGAGGATGCTGAGGACGTGGATGTACCGAAAGGTGCCAAGCAATCAAAGCTGCTGAAGGA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17042R-4.in silico     241 GGAGGATGCTGAGGACGTGGATGTACCGAAAGGTGCCAAGCAATCAAAGCTGCTGAAGGA 300


17042R-4.IR_full       301 TGTCACGCCGGAATCGGATTATGCATCGGAAGCCAATTATCCGGCAAATGAGGCGAGCGA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17042R-4.in silico     301 TGTCACGCCGGAATCGGATTATGCATCGGAAGCCAATTATCCGGCAAATGAGGCGAGCGA 360


17042R-4.IR_full       361 TGACACGGAATCCGACGATGAGGATGAGCCGGGCAGCACGGTATATTTCATGAAACTGCC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17042R-4.in silico     361 TGACACGGAATCCGACGATGAGGATGAGCCGGGCAGCACGGTATATTTCATGAAACTGCC 420


17042R-4.IR_full       421 ANGCGNNCGCCGCCGAGGATACGTATTCTTCTACGGAGGACGAGGATGACAGCGATTTCC 480
                           | |||  |||||||||||||||||||||||||||||||||||||||||||||||||||||
17042R-4.in silico     421 A-GCGGCCGCCGCCGAGGATACGTATTCTTCTACGGAGGACGAGGATGACAGCGATTTCC 480


17042R-4.IR_full       481 TGAACACCACCTACACGTGGA 501
                           |||||||||||||||||||||
17042R-4.in silico     481 TGAACACCACCTACACGTGGA 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_137017.1  CG17042-RA (CG17042), mRNA 
0.2   NM_136000.2  CG6453-RA (CG6453), mRNA 
0   NM_137902.1  CG13542-RA (CG13542), mRNA 
0   14  NM_140688.2  CG7728-RA (CG7728), mRNA 
0   NM_057513.3  CG8153-RA, transcript variant A (mus210), mRNA 
0   NM_166087.1  CG8153-RC, transcript variant C (mus210), mRNA 
0   NM_140803.1  CG14073-RB, transcript variant B (CG14073), mRNA 
0   NM_057990.3  CG2711-RA (dwg), mRNA 
0   NM_136343.1  CG12551-RA (CG12551), mRNA 
0   NM_080362.2  CG31868-RA (Samuel), mRNA 
0   11  NM_141738.3  CG6303-RA (Bruce), mRNA 
0   NM_142429.2  CG7957-RA (MED17), mRNA 
0   NM_132179.2  CG1402-RA (CG1402), mRNA 
0   NM_176678.1  CG18166-RB, transcript variant B (CG18166), mRNA 
0   NM_166843.3  CG18166-RA, transcript variant A (CG18166), mRNA 
0   NM_079435.2  CG9262-RA (Shal), mRNA 
0   NM_132476.2  CG1657-RA (CG1657), mRNA 
0   NM_169061.1  CG1657-RA (CG1657), mRNA,4,5,-tris-phosphate receptor CG1063-RA, transcript variant A (Itp-r83A), mRNA 
0   NM_169060.1  CG1657-RA (CG1657), mRNA,4,5,-tris-phosphate receptor CG1063-RA, transcript variant A (Itp-r83A), mRNA,4,5,-tris-phosphate receptor CG1063-RB, transcript variant B (Itp-r83A), mRNA 
0   NM_167653.1  CG3400-RE, transcript variant E (Pfrx), mRNA 
0   NM_167655.1  CG3400-RH, transcript variant H (Pfrx), mRNA 
0   NM_164900.1  CG5680-RB (bsk), mRNA 
0   NM_167652.1  CG3400-RD, transcript variant D (Pfrx), mRNA 
0   NM_058103.2  CG3400-RG, transcript variant G (Pfrx), mRNA 
0   NM_167654.1  CG3400-RF, transcript variant F (Pfrx), mRNA 
0   NM_167651.1  CG3400-RA, transcript variant A (Pfrx), mRNA 
0   NM_058104.4  CG3400-RB, transcript variant B (Pfrx), mRNA 
0   NM_167656.1  CG3400-RI, transcript variant I (Pfrx), mRNA 
0   NM_134914.2  CG3332-RA, transcript variant A (CG3332), mRNA 
0   NM_164531.1  CG3332-RB, transcript variant B (CG3332), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
 
DM
 
VM
 
VB
 
Caspase-3 signal
N
DB
DC
DM
 
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.