National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 17042R-1 
 Symbol CG17042  Full Name CG17042 
 CG No CG17042  Old CG No CG17042 
 Synonyms CG17042 
 Accession No (Link to NCBI) NM_137017.1 
 Inserted Chr. lll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   GCGAAAGTTGTCAGCCATTGCCGAAATACCGAAAATCCTGTGCTCCACTTTGGCCACCGT 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| silico     61  GTCGCAGAATTTTGGCCGAATGAGTGAATCGGAGGTGGATGAGGATGACGTCGGGGAGGA 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GGAGGCCTATGTGCAGCGGAAGTTCTCCTACGACGAGGATGCCCTTGACTTTGAGCTGAG 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GAACGGGGAACAGGCAGGTGACACTGACAGTGATGAGGAAGATTTGGTGTTGGTTCGGGA 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 GGAGGATGCTGAGGACGTGGATGTACCGAAAGGTGCCAAGCAATCAAAGCTGCTGAAGGA 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 TGTCACGCCGGAATCGGATTATGCATCGGAAGCCAATTATCCGGCAAATGAGGCGAGCGA 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 TGACACGGAATCCGACGATGAGGATGAGCCGGGCAGCACGGTATATTTCATGAAACTGCC 420

                           | |||  ||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 A-GCGGCCGCCGCCGAGGATACGTATTCTTCTACGGAGGACGAGGATGACAGCGATTTCC 480

17042R-1.IR_full       481 TGAACACCACCTACACGTGGA 501
                           ||||||||||||||||||||| silico     481 TGAACACCACCTACACGTGGA 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_137017.1  CG17042-RA (CG17042), mRNA 
0.2   NM_136000.2  CG6453-RA (CG6453), mRNA 
0   NM_137902.1  CG13542-RA (CG13542), mRNA 
0   14  NM_140688.2  CG7728-RA (CG7728), mRNA 
0   NM_057513.3  CG8153-RA, transcript variant A (mus210), mRNA 
0   NM_166087.1  CG8153-RC, transcript variant C (mus210), mRNA 
0   NM_140803.1  CG14073-RB, transcript variant B (CG14073), mRNA 
0   NM_057990.3  CG2711-RA (dwg), mRNA 
0   NM_136343.1  CG12551-RA (CG12551), mRNA 
0   NM_080362.2  CG31868-RA (Samuel), mRNA 
0   11  NM_141738.3  CG6303-RA (Bruce), mRNA 
0   NM_142429.2  CG7957-RA (MED17), mRNA 
0   NM_132179.2  CG1402-RA (CG1402), mRNA 
0   NM_176678.1  CG18166-RB, transcript variant B (CG18166), mRNA 
0   NM_166843.3  CG18166-RA, transcript variant A (CG18166), mRNA 
0   NM_079435.2  CG9262-RA (Shal), mRNA 
0   NM_132476.2  CG1657-RA (CG1657), mRNA 
0   NM_169061.1  CG1657-RA (CG1657), mRNA,4,5,-tris-phosphate receptor CG1063-RA, transcript variant A (Itp-r83A), mRNA 
0   NM_169060.1  CG1657-RA (CG1657), mRNA,4,5,-tris-phosphate receptor CG1063-RA, transcript variant A (Itp-r83A), mRNA,4,5,-tris-phosphate receptor CG1063-RB, transcript variant B (Itp-r83A), mRNA 
0   NM_167653.1  CG3400-RE, transcript variant E (Pfrx), mRNA 
0   NM_167655.1  CG3400-RH, transcript variant H (Pfrx), mRNA 
0   NM_164900.1  CG5680-RB (bsk), mRNA 
0   NM_167652.1  CG3400-RD, transcript variant D (Pfrx), mRNA 
0   NM_058103.2  CG3400-RG, transcript variant G (Pfrx), mRNA 
0   NM_167654.1  CG3400-RF, transcript variant F (Pfrx), mRNA 
0   NM_167651.1  CG3400-RA, transcript variant A (Pfrx), mRNA 
0   NM_058104.4  CG3400-RB, transcript variant B (Pfrx), mRNA 
0   NM_167656.1  CG3400-RI, transcript variant I (Pfrx), mRNA 
0   NM_134914.2  CG3332-RA, transcript variant A (CG3332), mRNA 
0   NM_164531.1  CG3332-RB, transcript variant B (CG3332), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.