National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notice:

Suspension of shipments during Golden Week Holidays: From 30 April to 14 May, deadline 17 April.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 16935R-1 
 Symbol CG16935  Full Name CG16935 
 CG No CG16935  Old CG No CG16935 
 Synonyms DM_7303260, CG16935 
 Accession No (Link to NCBI) NM_137070.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAAGTACACACAGCACGGCGAA 
 Primer Seq. 3'
aatctagaggtaccCCAACGCTATTGATGCCCCAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AAGTACACAC AGCACGGCGA ACCACAGGAG GTTCTGCAAC TGGTGGAGGA CAAACTTCCC 
0061 GATCCCAAGG ACAACCAGGT GCTGGTGAAG ATTCTGGCAG CTCCCATTAA CCCGGCGGAC 
0121 ATAAACACCA TTCAGGGTAA ATACCCGGTG AAGCCCAAGT TTNCCAGCCG TTGGCGGCAA 
0181 NTGAGTGTGT GGCGGAGGTC ATCTGCGTGG GCGACAAAGT CAAAGGCTTT GAGGCAGGAC 
0241 AGCACGTCAT TCCCTTGGCC AGTGGCCTGG GCACCTGGAC CACCCATGCC GTCTACAAGG 
0301 AGGATCAACT ATTGATCGTG TCCAAAAAGG TTGGCTTGGc GGAGGCCGCC ACCCTCGACA 
0361 GTGAATCCCA CCACTGCCTA CCGCATGCTA AAGGACTTTG TGCAGCTTTG TCCGGGTGAC 
0421 ACGGTCATCC AAAACGGAGC CAATAGCGCC GTCGGCCAGG CAGTGCACCA ATTGTGCCGA 
0481 gCCTGGGGCA TCAATAGCGT TGG 
 in silico PCR Fragment
0001 AAGTACACAC AGCACGGCGA ACCACAGGAG GTTCTGCAAC TGGTGGAGGA CAAACTTCCC 
0061 GATCCCAAGG ACAACCAGGT GCTGGTGAAG ATTCTGGCAG CTCCCATTAA CCCGGCGGAC 
0121 ATAAACACCA TTCAGGGTAA ATACCCGGTG AAGCCCAAGT TT-CCAGCCG TTGGCGGCAA 
0181 -TGAGTGTGT GGCGGAGGTC ATCTGCGTGG GCGACAAAGT CAAAGGCTTT GAGGCAGGAC 
0241 AGCACGTCAT TCCCTTGGCC AGTGGCCTGG GCACCTGGAC CACCCATGCC GTCTACAAGG 
0301 AGGATCAACT ATTGATCGTG TCCAAGAAGG TTGGCTTGGC GGAGGCCGCC A-CCTCGACA 
0361 GTGAATCCCA CCACTGCCTA CCGAATGCTA AAGGACTTTG TGCAGCTCTG TCCGGGTGAC 
0421 ACGGTCATCC AAAACGGCGC CAATAGCGCC GTCGGCCAGG CAGTGCACCA ATTGTGCCGA 
0481 GCCTGGGGCA TCAATAGCGT TGG 
 Assemble Data

16935R-1.IR_full       1   AAGTACACACAGCACGGCGAACCACAGGAGGTTCTGCAACTGGTGGAGGACAAACTTCCC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16935R-1.in silico     1   AAGTACACACAGCACGGCGAACCACAGGAGGTTCTGCAACTGGTGGAGGACAAACTTCCC 60


16935R-1.IR_full       61  GATCCCAAGGACAACCAGGTGCTGGTGAAGATTCTGGCAGCTCCCATTAACCCGGCGGAC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16935R-1.in silico     61  GATCCCAAGGACAACCAGGTGCTGGTGAAGATTCTGGCAGCTCCCATTAACCCGGCGGAC 120


16935R-1.IR_full       121 ATAAACACCATTCAGGGTAAATACCCGGTGAAGCCCAAGTTTNCCAGCCGTTGGCGGCAA 180
                           |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
16935R-1.in silico     121 ATAAACACCATTCAGGGTAAATACCCGGTGAAGCCCAAGTTT-CCAGCCGTTGGCGGCAA 180


16935R-1.IR_full        181 TGAGTGTGTGGCGGAGGTCATCTGCGTGGGCGACAAAGTCAAAGGCTTTGAGGCAGGAC 239
                            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16935R-1.in silico      181 TGAGTGTGTGGCGGAGGTCATCTGCGTGGGCGACAAAGTCAAAGGCTTTGAGGCAGGAC 239


16935R-1.IR_full       241 AGCACGTCATTCCCTTGGCCAGTGGCCTGGGCACCTGGACCACCCATGCCGTCTACAAGG 299
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16935R-1.in silico     241 AGCACGTCATTCCCTTGGCCAGTGGCCTGGGCACCTGGACCACCCATGCCGTCTACAAGG 299


16935R-1.IR_full       301 AGGATCAACTATTGATCGTGTCCAAAAAGGTTGGCTTGGCGGAGGCCGCCACCCTCGACA 359
                           ||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||
16935R-1.in silico     301 AGGATCAACTATTGATCGTGTCCAAGAAGGTTGGCTTGGCGGAGGCCGCCA-CCTCGACA 359


16935R-1.IR_full       361 GTGAATCCCACCACTGCCTACCGCATGCTAAAGGACTTTGTGCAGCTTTGTCCGGGTGAC 419
                           ||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||
16935R-1.in silico     361 GTGAATCCCACCACTGCCTACCGAATGCTAAAGGACTTTGTGCAGCTCTGTCCGGGTGAC 419


16935R-1.IR_full       421 ACGGTCATCCAAAACGGAGCCAATAGCGCCGTCGGCCAGGCAGTGCACCAATTGTGCCGA 479
                           ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
16935R-1.in silico     421 ACGGTCATCCAAAACGGCGCCAATAGCGCCGTCGGCCAGGCAGTGCACCAATTGTGCCGA 479


16935R-1.IR_full       481 GCCTGGGGCATCAATAGCGTTGG 502
                           |||||||||||||||||||||||
16935R-1.in silico     481 GCCTGGGGCATCAATAGCGTTGG 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_137070.1  CG16935-RA (CG16935), mRNA 
0   NM_001032399.1  CG33955-RB (eys), mRNA 
0   NM_140177.1  CG6272-RA (CG6272), mRNA 
0   NM_140665.1  CG9674-RA, transcript variant A (CG9674), mRNA 
0   NM_176339.1  CG9674-RD, transcript variant D (CG9674), mRNA 
0   NM_139387.1  CG7980-RA (RabX5), mRNA 
0   11  NM_166019.1  CG18076-RH, transcript variant H (shot), mRNA 
0   NM_176153.1  CG33013-RB (CG33013), mRNA 
0   NM_132199.2  CG2206-RA, transcript variant A (l(1)G0193), mRNA 
0   NM_165889.1  CG30043-RA (CG30043), mRNA 
0   NM_001042822.1  CG34120-RC, transcript variant C (CG34120), mRNA 
0   NM_137794.2  CG11073-RA (CG11073), mRNA 
0   NM_140132.3  CG32056-RA, transcript variant A (CG32056), mRNA 
0   NM_165954.1  CG3644-RB, transcript variant B (bic), mRNA 
0   NM_057505.3  CG3644-RA, transcript variant A (bic), mRNA 
0   NM_138219.1  CG13902-RA (CG13902), mRNA 
0   NM_079073.1  CG8595-RA (Toll-7), mRNA 
0   NM_140625.2  CG4818-RA (CG4818), mRNA 
0   NM_169657.1  CG5166-RB, transcript variant B (Atx2), mRNA 
0   NM_142209.2  CG5166-RA, transcript variant A (Atx2), mRNA 
0   NM_169658.2  CG5166-RC, transcript variant C (Atx2), mRNA 
0   11  NM_139364.2  CG1049-RA, transcript variant A (Cct1), mRNA 
0   11  NM_167894.1  CG1049-RD, transcript variant D (Cct1), mRNA 
0   11  NM_167892.1  CG1049-RB, transcript variant B (Cct1), mRNA 
0   11  NM_167893.1  CG1049-RC, transcript variant C (Cct1), mRNA 
0   NM_058112.3  CG13388-RA, transcript variant A (Akap200), mRNA 
0   NM_175984.1  CG13388-RD, transcript variant D (Akap200), mRNA 
0   NM_001043019.1  CG17800-PAS (Dscam), mRNA 
0   NM_001043059.1  CG17800-PAO (Dscam), mRNA 
0   NM_001043026.1  CG17800-RY, transcript variant Y (Dscam), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.