National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 16933R-3 
 Symbol NLaz  Full Name Neural Lazarillo 
 CG No CG33126  Old CG No CG16933 
 Synonyms CT33980, CG16933, CG33126, BcDNA:RE67583, NLaz 
 Accession No (Link to NCBI) NM_175946.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   TCGAGTTCGCACCTGTTGCTGCTTATCTCCGTGGTATTTGGGGCAGTATGGGTGGCCCA- 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  TGCCCAGGTGCCATTTCCTGGCAAGTGCCCAGATGTTAAGCTACTGGACACCTTCGACGC 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GGAAGCGTATATGGGCGTCTGGTACGAGTACGCAGCCTATCCATTTGCTTTCGAGATCGG 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 CAAGAAGTGCATCTACGCCAACTACAGTCTCATAGACAACAGCACTGTTTCGGTGGTGAA 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 TGCGGCCATCAATCGATTCACCGGACAACCCTCGAATGTAACTGGACAGGCCAAGGTCCT 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 TGGACCCGGTCAATTGGCCGTGGCCTTTTACCCGACGCAGCCATTGACGAAGGCCAACTA 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 CCTGGTTTTGGGCACAGATTACGAGTCATACGCCGTCGTCTACAGCTGCACCAGTGTAAC 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 ACCTTTGGCCAATTTCAAAATTGTTTGGATCTTGACTCGTCAGCGTGAACCTTCAGCGGA 480

16933R-3.IR_full       481 AGCGGTTGATGCGGCCAGAAA 501
                           ||||||||||||||||||||| silico     481 AGCGGTTGATGCGGCCAGAAA 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_175946.1  CG33126-RA (NLaz), mRNA 
0.2   NM_132816.2  CG7872-RA (CG7872), mRNA 
0   NM_142606.2  CG10889-RA (CG10889), mRNA 
0   NM_135755.1  CG9932-RA (CG9932), mRNA 
0   NM_165580.2  CG8726-RA, transcript variant A (CG8726), mRNA 
0   NM_136497.3  CG8726-RB, transcript variant B (CG8726), mRNA 
0   NM_167869.1  CG9184-RA, transcript variant A (CG9184), mRNA 
0   NM_138255.1  CG9184-RB, transcript variant B (CG9184), mRNA 
0   NM_140595.1  CG13054-RA (CG13054), mRNA 
0   NR_001733.1  CR30068, miscRNA 
0   NM_079184.3  CG14979-RA (Gr63a), mRNA 
0   NM_165024.1  CG31856-RA (CG31856), mRNA 
0   NM_079259.2  CG4974-RA (dally), mRNA 
0   NM_140327.1  CG10522-RA (sti), mRNA 
0   NM_057641.3  CG3052-RA (HLH4C), mRNA 
0   NM_078769.2  CG11181-RA (cup), mRNA 
0   NM_143480.2  CG18041-RA (CG18041), mRNA 
0   NM_001031989.2  CG33936-RC, transcript variant C (CG33936), mRNA 
0   NM_001031991.2  CG33936-RA, transcript variant A (CG33936), mRNA 
0   NM_001031990.2  CG33936-RB, transcript variant B (CG33936), mRNA 
0   NM_001031988.2  CG33936-RD, transcript variant D (CG33936), mRNA 
0   NM_139695.1  CG4597-RA (CG4597), mRNA 
0   NM_079308.2  CG18593-RA (viaf), mRNA 
0   NM_167487.1  CG32577-RA (disco-r), mRNA 
0   NM_132897.1  CG4301-RA (CG4301), mRNA 
0   NM_001043126.1  CG34158-RD, transcript variant D (SP2523), mRNA 
0   NM_001043125.1  CG34158-RC, transcript variant C (SP2523), mRNA 
0   NM_167985.1  CG14955-RB, transcript variant B (CG14955), mRNA 
0   NM_139512.1  CG14955-RA, transcript variant A (CG14955), mRNA 
0   NM_169206.1  CG9656-RA (grn), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.