National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 16933R-1 
 Symbol NLaz  Full Name Neural Lazarillo 
 CG No CG33126  Old CG No CG16933 
 Synonyms CT33980, CG16933, CG33126, BcDNA:RE67583, NLaz 
 Accession No (Link to NCBI) NM_175946.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment balanced with Green Balancer. TM3, P{w[+mC]=ActGFP}JMR2, Ser[1] 
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTCGAGTTCGCACCTGTTGCTG 
 Primer Seq. 3'
aatctagaggtaccTTTCTGGCCGCATCAACCGCT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TCGAGTTCGC ACCTGTTGCT GCTTATCTCC GTGGTATTTG GGGCAGTATG GGTGGCCCAT 
0061 TGCCCAGGTG CCATTTCCTG GCAAGTGCCC AGATGTTAAG CTACTGGACA CCTTCGACGC 
0121 GGAAGCGTAT ATGGGCGTCT GGTACGAGTA CGCAGCCTAT CCATTTGCTT TCGAGATCGG 
0181 CAAGAAGTGC ATCTACGCCA ACTACAGTCT CATAGACAAC AGCACTGTTT CGGTGGTGAA 
0241 TGCGGCCATC AATCGATTCA CCGGACAACC CTCGAATGTA ACTGGACAGG CCAAGGTCCT 
0301 TGGACCCGGT CAATTGGCCG TGGCCTTTTA CCCGACGCAG CCATTGACGA AGGCCAACTA 
0361 CCTGGTTTTG GGCACAGATT ACGAGTCATA CGCCGTCGTC TACAGCTGCA CCAGTGTAAC 
0421 ACCTTTGGCC AATTTCAAAA TTGTTTGGAT CTTGACTCGT CAGCGTGAAC CTTCAGCGGA 
0481 AGCGGTTGAT gCGGCCAGAA A 
 in silico PCR Fragment
0001 TCGAGTTCGC ACCTGTTGCT GCTTATCTCC GTGGTATTTG GGGCAGTATG GGTGGCCCA- 
0061 TGCCCAGGTG CCATTTCCTG GCAAGTGCCC AGATGTTAAG CTACTGGACA CCTTCGACGC 
0121 GGAAGCGTAT ATGGGCGTCT GGTACGAGTA CGCAGCCTAT CCATTTGCTT TCGAGATCGG 
0181 CAAGAAGTGC ATCTACGCCA ACTACAGTCT CATAGACAAC AGCACTGTTT CGGTGGTGAA 
0241 TGCGGCCATC AATCGATTCA CCGGACAACC CTCGAATGTA ACTGGACAGG CCAAGGTCCT 
0301 TGGACCCGGT CAATTGGCCG TGGCCTTTTA CCCGACGCAG CCATTGACGA AGGCCAACTA 
0361 CCTGGTTTTG GGCACAGATT ACGAGTCATA CGCCGTCGTC TACAGCTGCA CCAGTGTAAC 
0421 ACCTTTGGCC AATTTCAAAA TTGTTTGGAT CTTGACTCGT CAGCGTGAAC CTTCAGCGGA 
0481 AGCGGTTGAT GCGGCCAGAA A 
 Assemble Data

16933R-1.IR_full       1   TCGAGTTCGCACCTGTTGCTGCTTATCTCCGTGGTATTTGGGGCAGTATGGGTGGCCCAT 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
16933R-1.in silico     1   TCGAGTTCGCACCTGTTGCTGCTTATCTCCGTGGTATTTGGGGCAGTATGGGTGGCCCA- 60


16933R-1.IR_full       61  TGCCCAGGTGCCATTTCCTGGCAAGTGCCCAGATGTTAAGCTACTGGACACCTTCGACGC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16933R-1.in silico     61  TGCCCAGGTGCCATTTCCTGGCAAGTGCCCAGATGTTAAGCTACTGGACACCTTCGACGC 120


16933R-1.IR_full       121 GGAAGCGTATATGGGCGTCTGGTACGAGTACGCAGCCTATCCATTTGCTTTCGAGATCGG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16933R-1.in silico     121 GGAAGCGTATATGGGCGTCTGGTACGAGTACGCAGCCTATCCATTTGCTTTCGAGATCGG 180


16933R-1.IR_full       181 CAAGAAGTGCATCTACGCCAACTACAGTCTCATAGACAACAGCACTGTTTCGGTGGTGAA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16933R-1.in silico     181 CAAGAAGTGCATCTACGCCAACTACAGTCTCATAGACAACAGCACTGTTTCGGTGGTGAA 240


16933R-1.IR_full       241 TGCGGCCATCAATCGATTCACCGGACAACCCTCGAATGTAACTGGACAGGCCAAGGTCCT 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16933R-1.in silico     241 TGCGGCCATCAATCGATTCACCGGACAACCCTCGAATGTAACTGGACAGGCCAAGGTCCT 300


16933R-1.IR_full       301 TGGACCCGGTCAATTGGCCGTGGCCTTTTACCCGACGCAGCCATTGACGAAGGCCAACTA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16933R-1.in silico     301 TGGACCCGGTCAATTGGCCGTGGCCTTTTACCCGACGCAGCCATTGACGAAGGCCAACTA 360


16933R-1.IR_full       361 CCTGGTTTTGGGCACAGATTACGAGTCATACGCCGTCGTCTACAGCTGCACCAGTGTAAC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16933R-1.in silico     361 CCTGGTTTTGGGCACAGATTACGAGTCATACGCCGTCGTCTACAGCTGCACCAGTGTAAC 420


16933R-1.IR_full       421 ACCTTTGGCCAATTTCAAAATTGTTTGGATCTTGACTCGTCAGCGTGAACCTTCAGCGGA 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16933R-1.in silico     421 ACCTTTGGCCAATTTCAAAATTGTTTGGATCTTGACTCGTCAGCGTGAACCTTCAGCGGA 480


16933R-1.IR_full       481 AGCGGTTGATGCGGCCAGAAA 501
                           |||||||||||||||||||||
16933R-1.in silico     481 AGCGGTTGATGCGGCCAGAAA 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_175946.1  CG33126-RA (NLaz), mRNA 
0.2   NM_132816.2  CG7872-RA (CG7872), mRNA 
0   NM_142606.2  CG10889-RA (CG10889), mRNA 
0   NM_135755.1  CG9932-RA (CG9932), mRNA 
0   NM_165580.2  CG8726-RA, transcript variant A (CG8726), mRNA 
0   NM_136497.3  CG8726-RB, transcript variant B (CG8726), mRNA 
0   NM_167869.1  CG9184-RA, transcript variant A (CG9184), mRNA 
0   NM_138255.1  CG9184-RB, transcript variant B (CG9184), mRNA 
0   NM_140595.1  CG13054-RA (CG13054), mRNA 
0   NR_001733.1  CR30068, miscRNA 
0   NM_079184.3  CG14979-RA (Gr63a), mRNA 
0   NM_165024.1  CG31856-RA (CG31856), mRNA 
0   NM_079259.2  CG4974-RA (dally), mRNA 
0   NM_140327.1  CG10522-RA (sti), mRNA 
0   NM_057641.3  CG3052-RA (HLH4C), mRNA 
0   NM_078769.2  CG11181-RA (cup), mRNA 
0   NM_143480.2  CG18041-RA (CG18041), mRNA 
0   NM_001031989.2  CG33936-RC, transcript variant C (CG33936), mRNA 
0   NM_001031991.2  CG33936-RA, transcript variant A (CG33936), mRNA 
0   NM_001031990.2  CG33936-RB, transcript variant B (CG33936), mRNA 
0   NM_001031988.2  CG33936-RD, transcript variant D (CG33936), mRNA 
0   NM_139695.1  CG4597-RA (CG4597), mRNA 
0   NM_079308.2  CG18593-RA (viaf), mRNA 
0   NM_167487.1  CG32577-RA (disco-r), mRNA 
0   NM_132897.1  CG4301-RA (CG4301), mRNA 
0   NM_001043126.1  CG34158-RD, transcript variant D (SP2523), mRNA 
0   NM_001043125.1  CG34158-RC, transcript variant C (SP2523), mRNA 
0   NM_167985.1  CG14955-RB, transcript variant B (CG14955), mRNA 
0   NM_139512.1  CG14955-RA, transcript variant A (CG14955), mRNA 
0   NM_169206.1  CG9656-RA (grn), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.