National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 16928R-1 
 Symbol mre11  Full Name meiotic recombination 11 
 CG No CG16928  Old CG No CG16928 
 Synonyms MRE11, Mre11, CG16928, mre11 
 Accession No (Link to NCBI) NM_078823.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Hosono C, Matsuda R, Adryan B, Samakovlis C.
Transient junction anisotropies orient annular cell polarization in the Drosophila airway tubes.
Nat. Cell Biol. (2015) 17(12) 1569-76 [ PubMed ID = 26551273 ] [ RRC reference ]

Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGAATGGCACCACGACAGCA 
 Primer Seq. 3'
aatctagaggtaccCTGATCTCCACCTGGGTTAGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATGAATGGCA CCACGACAGC AGAGCAGGAT GCTGACAACG TGATTCGCAT CCTGGTGGCT 
0061 ACCGACAACC ACCTGGGCTA TGGCGAAAAA GACGCGGTGC GCGGCGAGGA CAGTTTCACG 
0121 GCCTTCGAGG AGATCCTGGA ACTGGCGGTG TCCGAGGATG TGGACATGAT TCTGCTGGGA 
0181 GGTGACCTCT TCCACGACGC CGTGCCCAGC CAGAATGCGT TGCACAAATG CATTGAGCTC 
0241 CTGCGGCGCT ACACATTCGG TGATCGTCCT GTTTCCCTGG AGATTCTCAG CGACCAGGGG 
0301 CAATGCTTCC ACAATGCCGT TAACCAGTCG GTGAATTACG AGGATCCCAA TCTGAACATT 
0361 GCCATTCCAG TATTCTCTAT TCATGGCAAT CACGACGATC CCAGTGGCTT CGGTCGTTTA 
0421 AGTTCTCTGG ATTTGCTGAG CACATCGGGA CTGGTTAACT ATTTTGGTCG GTGGACCGAT 
0481 CTAACCCAGG TGGAGATCAG  
 in silico PCR Fragment
0001 ATGAATGGCA CCACGACAGC AGAGCAGGAT GCTGACAACG TGATTCGCAT CCTGGTGGCT 
0061 ACCGACAACC ACCTGGGCTA TGGCGAAAAA GACGCGGTGC GCGGCGAGGA CAGTTTCACG 
0121 GCCTTCGAGG AGATCCTGGA ACTGGCGGTG TCCGAGGATG TGGACATGAT TCTGCTGGGA 
0181 GGTGACCTCT TCCACGACGC CGTGCCCAGC CAGAATGCGT TGCACAAATG CATTGAGCTC 
0241 CTGCGGCGCT ACACATTCGG TGATCGTCCT GTTTCCCTGG AGATTCTCAG CGACCAGGGG 
0301 CAATGCTTCC ACAATGCCGT TAACCAGTCG GTGAATTACG AGGATCCCAA TCTGAACATT 
0361 GCCATTCCAG TATTCTCTAT TCATGGCAAT CACGACGATC CCAGTGGCTT CGGTCGTTTA 
0421 AGTTCTCTGG ATTTGCTGAG CACCTCGGGA CTGGTTAACT ATTTTGGTCG GTGGACCGAT 
0481 CTAACCCAGG TGGAGATCAG  
 Assemble Data

16928R-1.IR_full       1   ATGAATGGCACCACGACAGCAGAGCAGGATGCTGACAACGTGATTCGCATCCTGGTGGCT 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16928R-1.in silico     1   ATGAATGGCACCACGACAGCAGAGCAGGATGCTGACAACGTGATTCGCATCCTGGTGGCT 60


16928R-1.IR_full       61  ACCGACAACCACCTGGGCTATGGCGAAAAAGACGCGGTGCGCGGCGAGGACAGTTTCACG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16928R-1.in silico     61  ACCGACAACCACCTGGGCTATGGCGAAAAAGACGCGGTGCGCGGCGAGGACAGTTTCACG 120


16928R-1.IR_full       121 GCCTTCGAGGAGATCCTGGAACTGGCGGTGTCCGAGGATGTGGACATGATTCTGCTGGGA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16928R-1.in silico     121 GCCTTCGAGGAGATCCTGGAACTGGCGGTGTCCGAGGATGTGGACATGATTCTGCTGGGA 180


16928R-1.IR_full       181 GGTGACCTCTTCCACGACGCCGTGCCCAGCCAGAATGCGTTGCACAAATGCATTGAGCTC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16928R-1.in silico     181 GGTGACCTCTTCCACGACGCCGTGCCCAGCCAGAATGCGTTGCACAAATGCATTGAGCTC 240


16928R-1.IR_full       241 CTGCGGCGCTACACATTCGGTGATCGTCCTGTTTCCCTGGAGATTCTCAGCGACCAGGGG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16928R-1.in silico     241 CTGCGGCGCTACACATTCGGTGATCGTCCTGTTTCCCTGGAGATTCTCAGCGACCAGGGG 300


16928R-1.IR_full       301 CAATGCTTCCACAATGCCGTTAACCAGTCGGTGAATTACGAGGATCCCAATCTGAACATT 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16928R-1.in silico     301 CAATGCTTCCACAATGCCGTTAACCAGTCGGTGAATTACGAGGATCCCAATCTGAACATT 360


16928R-1.IR_full       361 GCCATTCCAGTATTCTCTATTCATGGCAATCACGACGATCCCAGTGGCTTCGGTCGTTTA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16928R-1.in silico     361 GCCATTCCAGTATTCTCTATTCATGGCAATCACGACGATCCCAGTGGCTTCGGTCGTTTA 420


16928R-1.IR_full       421 AGTTCTCTGGATTTGCTGAGCACATCGGGACTGGTTAACTATTTTGGTCGGTGGACCGAT 480
                           ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
16928R-1.in silico     421 AGTTCTCTGGATTTGCTGAGCACCTCGGGACTGGTTAACTATTTTGGTCGGTGGACCGAT 480


16928R-1.IR_full       481 CTAACCCAGGTGGAGATCAG 500
                           ||||||||||||||||||||
16928R-1.in silico     481 CTAACCCAGGTGGAGATCAG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_078823.2  CG16928-RA (mre11), mRNA 
0   NM_137701.2  CG4030-RA (CG4030), mRNA 
0   NM_142267.2  CG5916-RA (CG5916), mRNA 
0   NM_080271.2  CG4625-RA (Dhap-at), mRNA 
0   NM_058040.3  CG10372-RA (Faf), mRNA 
0   NM_140424.1  CG9007-RA (CG9007), mRNA 
0   NM_140267.1  CG14126-RA (CG14126), mRNA 
0   NM_143348.2  CG4849-RA (CG4849), mRNA 
0   NM_078996.2  CG8770-RA (Gbeta76C), mRNA 
0   NM_142404.2  CG7357-RA (CG7357), mRNA 
0   NM_080377.2  CG10207-RA (NaPi-T), mRNA 
0   NM_136044.2  CG10333-RA (CG10333), mRNA 
0   NM_142683.2  CG7044-RA (CG7044), mRNA 
0   NM_170184.1  CG6238-RB, transcript variant B (ssh), mRNA 
0   NM_079768.2  CG6238-RA, transcript variant A (ssh), mRNA 
0   NM_057934.2  CG10297-RA (Acp65Aa), mRNA 
0   17  NM_144448.2  CG1915-RC, transcript variant C (sls), mRNA 
0   13  NM_079937.2  CG1915-RA, transcript variant A (sls), mRNA 
0   NM_001014453.1  CG33526-RD, transcript variant D (PNUTS), mRNA 
0   NM_167845.1  CG1086-RC, transcript variant C (Glut1), mRNA 
0   NM_079154.1  CG1086-RB, transcript variant B (Glut1), mRNA 
0   NM_078875.2  CG10446-RA (Side), mRNA 
0   NM_001014454.1  CG33526-RA, transcript variant A (PNUTS), mRNA 
0   NM_001014455.1  CG33526-RB, transcript variant B (PNUTS), mRNA 
0   NM_001014452.1  CG33526-RC, transcript variant C (PNUTS), mRNA 
0   11  NM_168278.1  CG32352-RB, transcript variant B (CG32352), mRNA 
0   11  NM_168279.2  CG32352-RA, transcript variant A (CG32352), mRNA 
0   11  NM_170629.2  CG32352-RC, transcript variant C (CG32352), mRNA 
0   NM_165168.1  CG31738-RA, transcript variant A (CG31738), mRNA 
0   NM_135957.2  CG31738-RB, transcript variant B (CG31738), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.