National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 16902R-2 
 Symbol Hr4  Full Name Hr4 
 CG No CG16902  Old CG No CG16902 
 Synonyms DHR4, NR6A2, GRF, EG:133E12.2, CG16902, Hr4 
 Accession No (Link to NCBI) NM_001038734.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Nitta Y, Yamazaki D, Sugie A, Hiroi M, Tabata T.
DISCO Interacting Protein 2 regulates axonal bifurcation and guidance of Drosophila mushroom body neurons.
Dev. Biol. (2017) 421(2) 233-244 [ PubMed ID = 27908785 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   CAGTAACAGCGTCGGGAGCAGGACCATGCGTCTCCACGTCGTCTACGACGGCAGCGGCAG 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  CCACATCCTCGACCTCCTCGCTCTCGTCCTCCTCCTCTTCGTCATCCTCCACGTCCTCCA 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GCACTTCCTCCGCCTCGCCGACAGCTGGAGCCTCCTCCACGGCCACCTGCCCCGCCAGCA 180

                           |||||||||||||||||||||| |||||  |||||||||||||||||||||||||||||| silico     181 GCAGCAGCAGCAGTGGAAACGG-AAGTGG-GGGCAAAAGTGGTAGCATCAAGCAGGAGCA 240

                           |||||||||||||||||||||||||||||||||  ||||||||| ||||||||||||||| silico     241 CACGGAGATACACTCGTCGAGCAGTGCGATTTCGGCGGCCGCCG-CCTCAACGGTGATGT 300

                           || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CA-CCGCCGCCCGCTGAGGCGACGAGATCCAGTCCAGCCACGCCCGAGGGAGGCGGACCA 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GCTGGCGACGGAAGTGGAGCAACGGGAGGCGGAAACACGAGCGGCGGATCAACGGCTGGA 420

                           ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| silico     421 GTGGCCATTAATGAACACCAAAACAATGGCAATGGCAGCGGCGGG-AGCAGTCGAGCCTC 480

16902R-2.IR_full       481 TCCCGATTCGCTGGAAGAGAAGCCC 505
                           ||||||||||||||||||||||||| silico     481 TCCCGATTCGCTGGAAGAGAAGCCC 505

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100.82  486  26  118  275  NM_001038734.1  CG16902-RC (Hr4), mRNA 
1.45   12  58  159  NM_078514.2  CG9653-RA (brk), mRNA 
1.03   79  330  734  NM_167335.1  CG4013-RC, transcript variant C (Smr), mRNA 
1.03   79  330  734  NM_167334.1  CG4013-RB, transcript variant B (Smr), mRNA 
1.03   79  330  734  NM_080536.2  CG4013-RA, transcript variant A (Smr), mRNA 
1.03   17  26  46  NM_169935.1  CG31191-RA (CG31191), mRNA 
0.82   12  36  NM_169245.2  CG31349-RA, transcript variant A (pyd), mRNA 
0.82   15  NM_135632.1  CG16743-RA (CG16743), mRNA 
0.82   16  NM_142432.2  CG7985-RA (CG7985), mRNA 
0.62   28  72  156  NM_079218.2  CG10491-RA, transcript variant A (vn), mRNA 
0.62   28  72  156  NM_001014565.1  CG10491-RB, transcript variant B (vn), mRNA 
0.62   16  73  142  NM_137212.2  CG30089-RA (CG30089), mRNA 
0.62   14  66  138  NM_132569.1  CG11245-RA (CG11245), mRNA 
0.62   14  62  148  NM_166873.1  CG3638-RB, transcript variant B (CG3638), mRNA 
0.62   14  62  148  NM_166872.1  CG3638-RD, transcript variant D (CG3638), mRNA 
0.62   14  62  148  NM_130541.3  CG3638-RC, transcript variant C (CG3638), mRNA 
0.62   14  62  148  NM_166874.1  CG3638-RA, transcript variant A (CG3638), mRNA 
0.62   13  26  44  NM_164869.1  CG18660-RA, transcript variant A (Nckx30C), mRNA 
0.62   13  26  44  NM_143754.2  CG18660-RC, transcript variant C (Nckx30C), mRNA 
0.62   13  26  44  NM_164870.1  CG18660-RB, transcript variant B (Nckx30C), mRNA 
0.62   10  26  95  NM_142210.1  CG6118-RA (CG6118), mRNA 
0.62   23  48  NM_141702.2  CG12806-RA (Teh1), mRNA 
0.62   17  26  NM_142106.1  CG14843-RA (CG14843), mRNA 
0.62   NM_166476.1  CG17921-RA, transcript variant A (HmgZ), mRNA 
0.62   NM_166477.1  CG17921-RB, transcript variant B (HmgZ), mRNA 
0.62   20  NM_140193.2  CG14141-RA (CG14141), mRNA 
0.62   23  NM_057349.4  CG31349-RB, transcript variant B (pyd), mRNA 
0.62   23  NM_169246.2  CG31349-RC, transcript variant C (pyd), mRNA 
0.62   21  NM_176426.2  CG31349-RF, transcript variant F (pyd), mRNA 
0.62   11  NM_078881.2  CG13968-RA, transcript variant A (sNPF), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.