National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 16902R-1 
 Symbol Hr4  Full Name Hr4 
 CG No CG16902  Old CG No CG16902 
 Synonyms DHR4, NR6A2, GRF, EG:133E12.2, CG16902, Hr4 
 Accession No (Link to NCBI) NM_001038734.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Perkins AD, Lee MJ, Tanentzapf G.
The systematic identification of cytoskeletal genes required for Drosophila melanogaster muscle maintenance.
Sci Data (2014) 1 140002 [ PubMed ID = 25977760 ] [ RRC reference ]

Fairchild MJ, Islam F, Tanentzapf G.
Identification of genetic networks that act in the somatic cells of the testis to mediate the developmental program of spermatogenesis.
PLoS Genet. (2017) 13(9) e1007026 [ PubMed ID = 28957323 ] [ RRC reference ]

Nitta Y, Yamazaki D, Sugie A, Hiroi M, Tabata T.
DISCO Interacting Protein 2 regulates axonal bifurcation and guidance of Drosophila mushroom body neurons.
Dev. Biol. (2017) 421(2) 233-244 [ PubMed ID = 27908785 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCAGTAACAGCGTCGGGAGCAG 
 Primer Seq. 3'
aatctagaggtaccGGGCTTCTCTTCCAGCGAATC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CAGTAACAGC GTCGGGAGCA GGACCATGCG TCTCCACGTC GTCTACGACG GCAGCGGCAG 
0061 CCACATCCTC GACCTCCTCG CTCTCGTCCT CCTCCTCTTC GTCATCCTCC ACGTCCTCCA 
0121 GCACTTCCTC CGCCTCGCCG ACAGCTGGAG CCTCCTCCAC GGCCACCTGC CCCGCCAGCA 
0181 GCAGCAGCAG CAGTGGAAAC GGNAAGTGTN GGGCAAAAGT GGTAGCATCA AGCAGGAGCA 
0241 CACGGAGATA CACTCGTCGA GCAGTGCGAT TTcNTCGGCC GCCGNCCTCA ACGGTGATGT 
0301 CANCCGCCGC CCGCTGAGGC GACGAGATCC AGTCCAGCCA CGCCCGAGGG AGGCGGACCA 
0361 GCTGGCGACG GAAGTGGAGC AACGGGAGGC GGAAACACGA GCGGCGGATC AACGGCTGGA 
0421 GTGGCCATTA ATGAACACCA AAACAATGGC AATGGCAGCG GCGGGCAGCA GTCGAGCCTC 
0481 TCCCGATTCG CTGGAAGAGA AGCCC 
 in silico PCR Fragment
0001 CAGTAACAGC GTCGGGAGCA GGACCATGCG TCTCCACGTC GTCTACGACG GCAGCGGCAG 
0061 CCACATCCTC GACCTCCTCG CTCTCGTCCT CCTCCTCTTC GTCATCCTCC ACGTCCTCCA 
0121 GCACTTCCTC CGCCTCGCCG ACAGCTGGAG CCTCCTCCAC GGCCACCTGC CCCGCCAGCA 
0181 GCAGCAGCAG CAGTGGAAAC GG-AAGTGG- GGGCAAAAGT GGTAGCATCA AGCAGGAGCA 
0241 CACGGAGATA CACTCGTCGA GCAGTGCGAT TTCGGCGGCC GCCG-CCTCA ACGGTGATGT 
0301 CA-CCGCCGC CCGCTGAGGC GACGAGATCC AGTCCAGCCA CGCCCGAGGG AGGCGGACCA 
0361 GCTGGCGACG GAAGTGGAGC AACGGGAGGC GGAAACACGA GCGGCGGATC AACGGCTGGA 
0421 GTGGCCATTA ATGAACACCA AAACAATGGC AATGGCAGCG GCGGG-AGCA GTCGAGCCTC 
0481 TCCCGATTCG CTGGAAGAGA AGCCC 
 Assemble Data

16902R-1.IR_full       1   CAGTAACAGCGTCGGGAGCAGGACCATGCGTCTCCACGTCGTCTACGACGGCAGCGGCAG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16902R-1.in silico     1   CAGTAACAGCGTCGGGAGCAGGACCATGCGTCTCCACGTCGTCTACGACGGCAGCGGCAG 60


16902R-1.IR_full       61  CCACATCCTCGACCTCCTCGCTCTCGTCCTCCTCCTCTTCGTCATCCTCCACGTCCTCCA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16902R-1.in silico     61  CCACATCCTCGACCTCCTCGCTCTCGTCCTCCTCCTCTTCGTCATCCTCCACGTCCTCCA 120


16902R-1.IR_full       121 GCACTTCCTCCGCCTCGCCGACAGCTGGAGCCTCCTCCACGGCCACCTGCCCCGCCAGCA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16902R-1.in silico     121 GCACTTCCTCCGCCTCGCCGACAGCTGGAGCCTCCTCCACGGCCACCTGCCCCGCCAGCA 180


16902R-1.IR_full       181 GCAGCAGCAGCAGTGGAAACGGNAAGTGTNGGGCAAAAGTGGTAGCATCAAGCAGGAGCA 240
                           |||||||||||||||||||||| |||||  ||||||||||||||||||||||||||||||
16902R-1.in silico     181 GCAGCAGCAGCAGTGGAAACGG-AAGTGG-GGGCAAAAGTGGTAGCATCAAGCAGGAGCA 240


16902R-1.IR_full       241 CACGGAGATACACTCGTCGAGCAGTGCGATTTCNTCGGCCGCCGNCCTCAACGGTGATGT 300
                           |||||||||||||||||||||||||||||||||  ||||||||| |||||||||||||||
16902R-1.in silico     241 CACGGAGATACACTCGTCGAGCAGTGCGATTTCGGCGGCCGCCG-CCTCAACGGTGATGT 300


16902R-1.IR_full       301 CANCCGCCGCCCGCTGAGGCGACGAGATCCAGTCCAGCCACGCCCGAGGGAGGCGGACCA 360
                           || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16902R-1.in silico     301 CA-CCGCCGCCCGCTGAGGCGACGAGATCCAGTCCAGCCACGCCCGAGGGAGGCGGACCA 360


16902R-1.IR_full       361 GCTGGCGACGGAAGTGGAGCAACGGGAGGCGGAAACACGAGCGGCGGATCAACGGCTGGA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16902R-1.in silico     361 GCTGGCGACGGAAGTGGAGCAACGGGAGGCGGAAACACGAGCGGCGGATCAACGGCTGGA 420


16902R-1.IR_full       421 GTGGCCATTAATGAACACCAAAACAATGGCAATGGCAGCGGCGGGCAGCAGTCGAGCCTC 480
                           ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
16902R-1.in silico     421 GTGGCCATTAATGAACACCAAAACAATGGCAATGGCAGCGGCGGG-AGCAGTCGAGCCTC 480


16902R-1.IR_full       481 TCCCGATTCGCTGGAAGAGAAGCCC 505
                           |||||||||||||||||||||||||
16902R-1.in silico     481 TCCCGATTCGCTGGAAGAGAAGCCC 505

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100.82  486  26  118  275  NM_001038734.1  CG16902-RC (Hr4), mRNA 
1.45   12  58  159  NM_078514.2  CG9653-RA (brk), mRNA 
1.03   79  330  734  NM_167335.1  CG4013-RC, transcript variant C (Smr), mRNA 
1.03   79  330  734  NM_167334.1  CG4013-RB, transcript variant B (Smr), mRNA 
1.03   79  330  734  NM_080536.2  CG4013-RA, transcript variant A (Smr), mRNA 
1.03   17  26  46  NM_169935.1  CG31191-RA (CG31191), mRNA 
0.82   12  36  NM_169245.2  CG31349-RA, transcript variant A (pyd), mRNA 
0.82   15  NM_135632.1  CG16743-RA (CG16743), mRNA 
0.82   16  NM_142432.2  CG7985-RA (CG7985), mRNA 
0.62   28  72  156  NM_079218.2  CG10491-RA, transcript variant A (vn), mRNA 
0.62   28  72  156  NM_001014565.1  CG10491-RB, transcript variant B (vn), mRNA 
0.62   16  73  142  NM_137212.2  CG30089-RA (CG30089), mRNA 
0.62   14  66  138  NM_132569.1  CG11245-RA (CG11245), mRNA 
0.62   14  62  148  NM_166873.1  CG3638-RB, transcript variant B (CG3638), mRNA 
0.62   14  62  148  NM_166872.1  CG3638-RD, transcript variant D (CG3638), mRNA 
0.62   14  62  148  NM_130541.3  CG3638-RC, transcript variant C (CG3638), mRNA 
0.62   14  62  148  NM_166874.1  CG3638-RA, transcript variant A (CG3638), mRNA 
0.62   13  26  44  NM_164869.1  CG18660-RA, transcript variant A (Nckx30C), mRNA 
0.62   13  26  44  NM_143754.2  CG18660-RC, transcript variant C (Nckx30C), mRNA 
0.62   13  26  44  NM_164870.1  CG18660-RB, transcript variant B (Nckx30C), mRNA 
0.62   10  26  95  NM_142210.1  CG6118-RA (CG6118), mRNA 
0.62   23  48  NM_141702.2  CG12806-RA (Teh1), mRNA 
0.62   17  26  NM_142106.1  CG14843-RA (CG14843), mRNA 
0.62   NM_166476.1  CG17921-RA, transcript variant A (HmgZ), mRNA 
0.62   NM_166477.1  CG17921-RB, transcript variant B (HmgZ), mRNA 
0.62   20  NM_140193.2  CG14141-RA (CG14141), mRNA 
0.62   23  NM_057349.4  CG31349-RB, transcript variant B (pyd), mRNA 
0.62   23  NM_169246.2  CG31349-RC, transcript variant C (pyd), mRNA 
0.62   21  NM_176426.2  CG31349-RF, transcript variant F (pyd), mRNA 
0.62   11  NM_078881.2  CG13968-RA, transcript variant A (sNPF), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.