National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 16890R-2 
 Symbol CG16890  Full Name CG16890 
 CG No CG16890  Old CG No CG16890 
 Synonyms BG:DS00797.4, CG16890 
 Accession No (Link to NCBI) NM_135827.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACAACCTGAGTGCCAAGGAGC 
 Primer Seq. 3'
aatctagaggtaccCCGTTCCTCCTTTTCCCTGCG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ACAACCTGAG TGCCAAGGAG CGACACAACT ATATACTTAG TAATTACGTG CTTAACCTAC 
0061 CGAATGAGAC GGAATCACGT CGGCACAAGC GAGACATCGA TGTAATCCGA GAGAATCACC 
0121 GCTTCCTGTG GGAGGACGAC GAGTTGGATA GCGACACCCT AAGCTGGGAG CAGCGCTTGG 
0181 CCCTGCGANT ACTACAGGAA GCTATTTAAG GAGTACTGCA NTCGCGGACC TGTCCCGCTA 
0241 CAAGGAGAAC AAGANTAGCG CTGCGCTGGC GAACGGAGCA GGAGGTGGTC ACCGGAACCG 
0301 GGCAGTTCCA GTGCGGCAGC CGGCATTGCG GGGAGCGGGA TAATCTGCGC AGCTGGGAGG 
0361 TAAACTTTAG GTATATCGAA AAGGGTGAGC CCCTAAATGC GCTGGTCAAG GTGCGGCTGT 
0421 GTCCCACCCA CACGGATCAG CTGAACTACC GCACCAAGAA GAGAGAATGC AAGAAGCGGA 
0481 GACGCAGGGA AAAGGAGGAA CGG 
 in silico PCR Fragment
0001 ACAACCTGAG TGCCAAGGAG CGACACAACT ATATACTTAG TAATTACGTG CTTAACCTAC 
0061 CGAATGAGAC GGAATCACGT CGGCACAAGC GAGACATCGA TGTAATCCGA GAGAATCACC 
0121 GCTTCCTGTG GGAGGACGAC GAGTTGGATA GCGACACCCT AAGCTGGGAG CAGCGCTTGG 
0181 CCCTGCGA-T ACTACAGGAA GCTATTTAAG GAGTACTGCA -TCGCGGACC TGTCCCGCTA 
0241 CAAGGAGAAC AAGA-TAGCG CTGCGCTGGC GAACGGAGCA GGAGGTGGTC ACCGGAACCG 
0301 GGCAGTTCCA GTGCGGCAGC CGGCATTGCG GGGAGCGGGA TAATCTGCGC AGCTGGGAGG 
0361 TAAACTTTAG GTATATCGAA AAGGGTGAGC CCCTAAATGC GCTGGTCAAG GTGCGGCTGT 
0421 GTCCCACCCA CACGGATCAG CTGAACTACC GCACCAAGAA GAGAGAATGC AAGAAGCGGA 
0481 GACGCAGGGA AAAGGAGGAA CGG 
 Assemble Data

16890R-2.IR_full       1   ACAACCTGAGTGCCAAGGAGCGACACAACTATATACTTAGTAATTACGTGCTTAACCTAC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16890R-2.in silico     1   ACAACCTGAGTGCCAAGGAGCGACACAACTATATACTTAGTAATTACGTGCTTAACCTAC 60


16890R-2.IR_full       61  CGAATGAGACGGAATCACGTCGGCACAAGCGAGACATCGATGTAATCCGAGAGAATCACC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16890R-2.in silico     61  CGAATGAGACGGAATCACGTCGGCACAAGCGAGACATCGATGTAATCCGAGAGAATCACC 120


16890R-2.IR_full       121 GCTTCCTGTGGGAGGACGACGAGTTGGATAGCGACACCCTAAGCTGGGAGCAGCGCTTGG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16890R-2.in silico     121 GCTTCCTGTGGGAGGACGACGAGTTGGATAGCGACACCCTAAGCTGGGAGCAGCGCTTGG 180


16890R-2.IR_full       181 CCCTGCGANTACTACAGGAAGCTATTTAAGGAGTACTGCANTCGCGGACCTGTCCCGCTA 240
                           |||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||
16890R-2.in silico     181 CCCTGCGA-TACTACAGGAAGCTATTTAAGGAGTACTGCA-TCGCGGACCTGTCCCGCTA 240


16890R-2.IR_full       241 CAAGGAGAACAAGANTAGCGCTGCGCTGGCGAACGGAGCAGGAGGTGGTCACCGGAACCG 300
                           |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
16890R-2.in silico     241 CAAGGAGAACAAGA-TAGCGCTGCGCTGGCGAACGGAGCAGGAGGTGGTCACCGGAACCG 300


16890R-2.IR_full       301 GGCAGTTCCAGTGCGGCAGCCGGCATTGCGGGGAGCGGGATAATCTGCGCAGCTGGGAGG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16890R-2.in silico     301 GGCAGTTCCAGTGCGGCAGCCGGCATTGCGGGGAGCGGGATAATCTGCGCAGCTGGGAGG 360


16890R-2.IR_full       361 TAAACTTTAGGTATATCGAAAAGGGTGAGCCCCTAAATGCGCTGGTCAAGGTGCGGCTGT 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16890R-2.in silico     361 TAAACTTTAGGTATATCGAAAAGGGTGAGCCCCTAAATGCGCTGGTCAAGGTGCGGCTGT 420


16890R-2.IR_full       421 GTCCCACCCACACGGATCAGCTGAACTACCGCACCAAGAAGAGAGAATGCAAGAAGCGGA 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16890R-2.in silico     421 GTCCCACCCACACGGATCAGCTGAACTACCGCACCAAGAAGAGAGAATGCAAGAAGCGGA 480


16890R-2.IR_full       481 GACGCAGGGAAAAGGAGGAACGG 503
                           |||||||||||||||||||||||
16890R-2.in silico     481 GACGCAGGGAAAAGGAGGAACGG 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   533  NM_165057.1  CG16890-RB, transcript variant B (CG16890), mRNA 
87.99   469  NM_135827.2  CG16890-RA, transcript variant A (CG16890), mRNA 
0   NM_001043308.1  CG34133-RB, transcript variant B (CG34133), mRNA 
0   NM_001043307.1  CG34133-RA, transcript variant A (CG34133), mRNA 
0   NM_143714.2  CG4746-RA (mab-2), mRNA 
0   NM_078523.2  CG2252-RB, transcript variant B (fs(1)h), mRNA 
0   NM_167144.2  CG2252-RA, transcript variant A (fs(1)h), mRNA 
0   NM_206647.1  CG2252-RC, transcript variant C (fs(1)h), mRNA 
0   NM_206646.1  CG2252-RD, transcript variant D (fs(1)h), mRNA 
0   NM_206645.1  CG2252-RE, transcript variant E (fs(1)h), mRNA 
0   NM_170499.2  CG9720-RA (PH4alphaNE2), mRNA 
0   NM_142725.1  CG13420-RA (CG13420), mRNA 
0   NM_057894.3  CG5799-RA, transcript variant A (dve), mRNA 
0   NM_057893.3  CG5799-RB, transcript variant B (dve), mRNA 
0   NM_080490.3  CG6571-RA, transcript variant A (rdgC), mRNA 
0   NM_143009.1  CG6607-RA (CG6607), mRNA 
0   NM_170516.1  CG31015-RA (PH4alphaPV), mRNA 
0   NM_132009.2  CG11473-RA (CG11473), mRNA 
0   NM_142453.3  CG7125-RA, transcript variant A (PKD), mRNA 
0   NM_134731.2  CG4764-RA (CG4764), mRNA 
0   NM_169805.3  CG7125-RD, transcript variant D (PKD), mRNA 
0   NM_169803.3  CG7125-RB, transcript variant B (PKD), mRNA 
0   NM_169804.3  CG7125-RC, transcript variant C (PKD), mRNA 
0   NM_167026.2  CG6824-RB, transcript variant B (ovo), mRNA 
0   NM_080338.3  CG6824-RA, transcript variant A (ovo), mRNA 
0   NM_001038742.1  CG6824-RD, transcript variant D (ovo), mRNA 
0   NM_167027.2  CG6824-RC, transcript variant C (ovo), mRNA 
0   NM_143615.2  CG11518-RA (pygo), mRNA 
0   NM_166318.1  CG15105-RB, transcript variant B (CG15105), mRNA 
0   NM_137546.2  CG15105-RA, transcript variant A (CG15105), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.