National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 16890R-1 
 Symbol CG16890  Full Name CG16890 
 CG No CG16890  Old CG No CG16890 
 Synonyms BG:DS00797.4, CG16890 
 Accession No (Link to NCBI) NM_135827.2 
 Inserted Chr. lll 
 Insertional Mutation  semi-lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   ACAACCTGAGTGCCAAGGAGCGACACAACTATATACTTAGTAATTACGTGCTTAACCTAC 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  CGAATGAGACGGAATCACGTCGGCACAAGCGAGACATCGATGTAATCCGAGAGAATCACC 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GCTTCCTGTGGGAGGACGACGAGTTGGATAGCGACACCCTAAGCTGGGAGCAGCGCTTGG 180

                           |||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||| silico     181 CCCTGCGA-TACTACAGGAAGCTATTTAAGGAGTACTGCA-TCGCGGACCTGTCCCGCTA 240

                           |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| silico     241 CAAGGAGAACAAGA-TAGCGCTGCGCTGGCGAACGGAGCAGGAGGTGGTCACCGGAACCG 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GGCAGTTCCAGTGCGGCAGCCGGCATTGCGGGGAGCGGGATAATCTGCGCAGCTGGGAGG 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 TAAACTTTAGGTATATCGAAAAGGGTGAGCCCCTAAATGCGCTGGTCAAGGTGCGGCTGT 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GTCCCACCCACACGGATCAGCTGAACTACCGCACCAAGAAGAGAGAATGCAAGAAGCGGA 480

16890R-1.IR_full       481 GACGCAGGGAAAAGGAGGAACGG 503
                           ||||||||||||||||||||||| silico     481 GACGCAGGGAAAAGGAGGAACGG 503

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   533  NM_165057.1  CG16890-RB, transcript variant B (CG16890), mRNA 
87.99   469  NM_135827.2  CG16890-RA, transcript variant A (CG16890), mRNA 
0   NM_001043308.1  CG34133-RB, transcript variant B (CG34133), mRNA 
0   NM_001043307.1  CG34133-RA, transcript variant A (CG34133), mRNA 
0   NM_143714.2  CG4746-RA (mab-2), mRNA 
0   NM_078523.2  CG2252-RB, transcript variant B (fs(1)h), mRNA 
0   NM_167144.2  CG2252-RA, transcript variant A (fs(1)h), mRNA 
0   NM_206647.1  CG2252-RC, transcript variant C (fs(1)h), mRNA 
0   NM_206646.1  CG2252-RD, transcript variant D (fs(1)h), mRNA 
0   NM_206645.1  CG2252-RE, transcript variant E (fs(1)h), mRNA 
0   NM_170499.2  CG9720-RA (PH4alphaNE2), mRNA 
0   NM_142725.1  CG13420-RA (CG13420), mRNA 
0   NM_057894.3  CG5799-RA, transcript variant A (dve), mRNA 
0   NM_057893.3  CG5799-RB, transcript variant B (dve), mRNA 
0   NM_080490.3  CG6571-RA, transcript variant A (rdgC), mRNA 
0   NM_143009.1  CG6607-RA (CG6607), mRNA 
0   NM_170516.1  CG31015-RA (PH4alphaPV), mRNA 
0   NM_132009.2  CG11473-RA (CG11473), mRNA 
0   NM_142453.3  CG7125-RA, transcript variant A (PKD), mRNA 
0   NM_134731.2  CG4764-RA (CG4764), mRNA 
0   NM_169805.3  CG7125-RD, transcript variant D (PKD), mRNA 
0   NM_169803.3  CG7125-RB, transcript variant B (PKD), mRNA 
0   NM_169804.3  CG7125-RC, transcript variant C (PKD), mRNA 
0   NM_167026.2  CG6824-RB, transcript variant B (ovo), mRNA 
0   NM_080338.3  CG6824-RA, transcript variant A (ovo), mRNA 
0   NM_001038742.1  CG6824-RD, transcript variant D (ovo), mRNA 
0   NM_167027.2  CG6824-RC, transcript variant C (ovo), mRNA 
0   NM_143615.2  CG11518-RA (pygo), mRNA 
0   NM_166318.1  CG15105-RB, transcript variant B (CG15105), mRNA 
0   NM_137546.2  CG15105-RA, transcript variant A (CG15105), mRNA 
 Wing Disc
JNK signal
Caspase-3 signal
Dcompartment   Penetrance

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.