National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 16863R-2 
 Symbol CG16863  Full Name CG16863 
 CG No CG16863  Old CG No CG16863 
 Synonyms DS00797.6, BG:DS00797.6, CG16863 
 Accession No (Link to NCBI) NM_135830.3 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGGAAGAACCTCTGCCGAGC 
 Primer Seq. 3'
aatctagaggtaccTGATGATGAGCGCCCATGAAC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATGGAAGAAC CTCTGCCGAG CGAGAGTCCG TTTCACAAGG ACATTGCCTT CTTTGTCTGC 
0061 CGTGACCGCC AGTCATTGCA GATTGTGCAG GGCGAGGGAT TCCAGCACCT AGTGAAAGTA 
0121 CTGTGCCCCA CCTACAGACC ACCGAGTGCG GCGAAACTGG AGGCCATTAT CTGCAGGGAG 
0181 TCGGAAGCGC AGAGGTCCAA GCTCTGCCAG CAGTTGGCCG ACATCTCGAC ACTCAGCCTA 
0241 AGTTGCTCGG TGCACACGAA TGCGGAGAGT CGAAGCTGGA TGGAGCTGGT GGCCCACTTT 
0301 CACGAGGGGC GGCAACGAAT CTCCCGAACT CTTTNTGNGN TGCGCCTTCC CGATCTTTTC 
0361 ACCTCCAACG ATCTGGTGGA TCGCATGGAC CAAGTGTGTC AGCGCTTCGA CATTCCAAAG 
0421 TCAAGGATCT GCTGCGTGTC GACAAGGAGC AGTCAACTAC TGGAGGATGC GGTGACATCG 
0481 TTCATGGGCG CTCATCATCA  
 in silico PCR Fragment
0001 ATGGAAGAAC CTCTGCCGAG CGAGAGTCCG TTTCACAAGG ACATTGCCTT CTTTGTCTGC 
0061 CGTGACCGCC AGTCATTGCA GATTGTGCAG GGCGAGGGAT TCCAGCACCT AGTGAAAGTA 
0121 CTGTGCCCCA CCTACAGACC ACCGAGTGCG GCGAAACTGG AGGCCATTAT CTGCAGGGAG 
0181 TCGGAAGCGC AGAGGTCCAA GCTCTGCCAG CAGTTGGCCG ACATCTCGAC ACTCAGCCTA 
0241 AGTTGCTCGG TGCACACGAA TGCGGAGAGT CGAAGCTGGA TGGAGCTGGT GGCCCACTTT 
0301 CACGAGGGGC GGCAACGAAT CTCCCGAACT CTTTCTGTGC TGCGCCTTCC CGATCTTTTC 
0361 ACCTCCAACG ATCTGGTGGA TCGCATGGAC CAAGTGTGTC AGCGCTTCGA CATTCCAAAG 
0421 TCAAGGATCT GCTGCGTGTC GACAAGGAGC AGTCAACTAC TGGAGGATGC GGTGACATCG 
0481 TTCATGGGCG CTCATCATCA  
 Assemble Data

16863R-2.IR_full       1   ATGGAAGAACCTCTGCCGAGCGAGAGTCCGTTTCACAAGGACATTGCCTTCTTTGTCTGC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16863R-2.in silico     1   ATGGAAGAACCTCTGCCGAGCGAGAGTCCGTTTCACAAGGACATTGCCTTCTTTGTCTGC 60


16863R-2.IR_full       61  CGTGACCGCCAGTCATTGCAGATTGTGCAGGGCGAGGGATTCCAGCACCTAGTGAAAGTA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16863R-2.in silico     61  CGTGACCGCCAGTCATTGCAGATTGTGCAGGGCGAGGGATTCCAGCACCTAGTGAAAGTA 120


16863R-2.IR_full       121 CTGTGCCCCACCTACAGACCACCGAGTGCGGCGAAACTGGAGGCCATTATCTGCAGGGAG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16863R-2.in silico     121 CTGTGCCCCACCTACAGACCACCGAGTGCGGCGAAACTGGAGGCCATTATCTGCAGGGAG 180


16863R-2.IR_full       181 TCGGAAGCGCAGAGGTCCAAGCTCTGCCAGCAGTTGGCCGACATCTCGACACTCAGCCTA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16863R-2.in silico     181 TCGGAAGCGCAGAGGTCCAAGCTCTGCCAGCAGTTGGCCGACATCTCGACACTCAGCCTA 240


16863R-2.IR_full       241 AGTTGCTCGGTGCACACGAATGCGGAGAGTCGAAGCTGGATGGAGCTGGTGGCCCACTTT 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16863R-2.in silico     241 AGTTGCTCGGTGCACACGAATGCGGAGAGTCGAAGCTGGATGGAGCTGGTGGCCCACTTT 300


16863R-2.IR_full       301 CACGAGGGGCGGCAACGAATCTCCCGAACTCTTTNTGNGNTGCGCCTTCCCGATCTTTTC 360
                           |||||||||||||||||||||||||||||||||| || | ||||||||||||||||||||
16863R-2.in silico     301 CACGAGGGGCGGCAACGAATCTCCCGAACTCTTTCTGTGCTGCGCCTTCCCGATCTTTTC 360


16863R-2.IR_full       361 ACCTCCAACGATCTGGTGGATCGCATGGACCAAGTGTGTCAGCGCTTCGACATTCCAAAG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16863R-2.in silico     361 ACCTCCAACGATCTGGTGGATCGCATGGACCAAGTGTGTCAGCGCTTCGACATTCCAAAG 420


16863R-2.IR_full       421 TCAAGGATCTGCTGCGTGTCGACAAGGAGCAGTCAACTACTGGAGGATGCGGTGACATCG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16863R-2.in silico     421 TCAAGGATCTGCTGCGTGTCGACAAGGAGCAGTCAACTACTGGAGGATGCGGTGACATCG 480


16863R-2.IR_full       481 TTCATGGGCGCTCATCATCA 500
                           ||||||||||||||||||||
16863R-2.in silico     481 TTCATGGGCGCTCATCATCA 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_135830.3  CG16863-RA, transcript variant A (CG16863), mRNA 
100   482  NM_001042896.1  CG16863-RB, transcript variant B (CG16863), mRNA 
0   NM_168081.1  CG32250-RA (CG32250), mRNA 
0   NM_001043091.1  CG5748-RC, transcript variant C (Hsf), mRNA 
0   NM_057227.3  CG5748-RA, transcript variant A (Hsf), mRNA 
0   NM_001043090.1  CG5748-RD, transcript variant D (Hsf), mRNA 
0   NM_001043092.1  CG5748-RB, transcript variant B (Hsf), mRNA 
0   NM_140914.2  CG7749-RA, transcript variant A (fat2), mRNA 
0   NM_001031967.1  CG7749-RB, transcript variant B (fat2), mRNA 
0   NM_132504.1  CG11695-RA (CG11695), mRNA 
0   NM_133158.2  CG12204-RA (CG12204), mRNA 
0   NM_143469.1  CG7837-RA (CG7837), mRNA 
0   NM_136043.2  CG10413-RA (CG10413), mRNA 
0   NM_137006.2  CG4663-RA (CG4663), mRNA 
0   NM_140466.1  CG5295-RA (CG5295), mRNA 
0   NM_165551.2  CG30496-RA (CG30496), mRNA 
0   NM_057527.3  CG6122-RA (piwi), mRNA 
0   NM_132832.2  CG8191-RA (CG8191), mRNA 
0   NM_144343.2  CG8250-RA (Alk), mRNA 
0   NM_001038732.1  CG12598-RC, transcript variant C (Adar), mRNA 
0   NM_130584.2  CG12598-RA, transcript variant A (Adar), mRNA 
0   NM_166903.1  CG12598-RB, transcript variant B (Adar), mRNA 
0   10  NM_166696.1  CG9071-RB, transcript variant B (NaCP60E), mRNA 
0   NM_080255.2  CG6889-RA, transcript variant A (tara), mRNA 
0   NM_169709.1  CG6889-RB, transcript variant B (tara), mRNA 
0   NM_168587.1  CG17697-RB, transcript variant B (fz), mRNA 
0   NM_080073.2  CG17697-RA, transcript variant A (fz), mRNA 
0   NM_138986.3  CG1168-RA, transcript variant A (7B2), mRNA 
0   NM_001014608.1  CG1168-RB, transcript variant B (7B2), mRNA 
0   NM_079903.2  CG15319-RB (nej), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
+- 
DC
++ 
DM
 
VM
 
VB
 
Caspase-3 signal
N
DB
DC
 
DM
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.