National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notification of resumption of orders:

Orders have been suspended as a response to the COVID-19 infection, but it will be resumed today, May 11. However, we would like to set our organizational framework that prioritizes the maintenance of stocks for the time being. In addition, due to delays in delivery of postal items, it is expected that the flies you ordered will not reach you in normal period. We apologize for the inconvenience.

Thank you for your understanding.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 16804R-2 
 Symbol CG33672  Full Name CG33672 
 CG No CG33672  Old CG No CG16804 
 Synonyms CG33009, CG8810, CG16804a, CG16804, CG33009-ORFA, CG33672 
 Accession No (Link to NCBI) NM_001032242.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAGATTTCGGCAGCTGGAGGAC 
 Primer Seq. 3'
aatctagaggtaccGAGGGCGTGCCATGATTAACA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AGATTTCGGC AGCTGGAGGA CAGCCAGGTG GCAAGTTTTC AACTGGAGGC CCTTAACTGC 
0061 ACACTGGAGA TCCAGTTGCC GGAGTTCGAT GGATTTTTGG CTGAATTTAG GAGTAAATAC 
0121 CCATCAGATA GCACGGCCAA TCTGTTGGAA GCCGTCCGCG CAGAGGTGTC CAAACAACTT 
0181 GAACGATCCG GAGNCAATGC ACCGAAGCAG CACACCCAGC GGGCATTCAT CTCCATATAC 
0241 TATTTGCTGG CCGGCGCTGT ACTCTCCGCA CCCGGCGACA AGAAACTGAC GCTGCAAACC 
0301 GGTTTCCAGG TGCAGGNAGA CAGCCAGCTA ACCGTGGGTG CGGGTTTGGG CAGTTCCGCC 
0361 TCTTTCGGAG CAGCTTTGGC CACGACATTT CTCATTTTGG CCGGACACTT TGATAGAGAC 
0421 AGCTACTTGT CGGAGGCAAA CCAGGCGTTG ATCTCGTCCT GGGCTTATGA ATCGGAGCGT 
0481 GTTAATCATG GCACGCCCTC  
 in silico PCR Fragment
0001 AGATTTCGGC AGCTGGAGGA CAGCCAGGTG GCAAGTTTTC AACTGGAGGC CCTTAACTGC 
0061 ACACTGGAGA TCCAGTTGCC GGAGTTCAAT GGATTTTTGG CTGAATTTAG GAGTAAATAC 
0121 CCATCAGATA GCACGGCCAA TCTGTTGGAA GCCGTCCGCG CAGAGGTGTC CAAACAACTT 
0181 GAACGATCCG GAGGCAATGC ACCGAAGCAG CACACCCAGC GGGCATTCAT CTCCATATAC 
0241 TATTTGCTGG CCGGCGCTGT ACTCTCCGCA CCCGGCGACA AGAAACTGAC GCTGCAAACC 
0301 GGTTTCCAGG TGCAGGTAGA CAGCCAGCTA ACCGTGGGTG CGGGTTTGGG CAGTTCCGCC 
0361 TCTTTCGGAG CAGCTTTGGC CACGACATTT CTCATTTTGG CCGGACACTT TGATAGAGAC 
0421 AGCTACTTGT CGGAGGCAAA CCAGGCGTTG ATCTCGTCCT GGGCTTATGA ATCGGAGCGT 
0481 GTTAATCATG GCACGCCCTC  
 Assemble Data

16804R-2.IR_full       1   AGATTTCGGCAGCTGGAGGACAGCCAGGTGGCAAGTTTTCAACTGGAGGCCCTTAACTGC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16804R-2.in silico     1   AGATTTCGGCAGCTGGAGGACAGCCAGGTGGCAAGTTTTCAACTGGAGGCCCTTAACTGC 60


16804R-2.IR_full       61  ACACTGGAGATCCAGTTGCCGGAGTTCGATGGATTTTTGGCTGAATTTAGGAGTAAATAC 120
                           ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
16804R-2.in silico     61  ACACTGGAGATCCAGTTGCCGGAGTTCAATGGATTTTTGGCTGAATTTAGGAGTAAATAC 120


16804R-2.IR_full       121 CCATCAGATAGCACGGCCAATCTGTTGGAAGCCGTCCGCGCAGAGGTGTCCAAACAACTT 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16804R-2.in silico     121 CCATCAGATAGCACGGCCAATCTGTTGGAAGCCGTCCGCGCAGAGGTGTCCAAACAACTT 180


16804R-2.IR_full       181 GAACGATCCGGAGNCAATGCACCGAAGCAGCACACCCAGCGGGCATTCATCTCCATATAC 240
                           ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
16804R-2.in silico     181 GAACGATCCGGAGGCAATGCACCGAAGCAGCACACCCAGCGGGCATTCATCTCCATATAC 240


16804R-2.IR_full       241 TATTTGCTGGCCGGCGCTGTACTCTCCGCACCCGGCGACAAGAAACTGACGCTGCAAACC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16804R-2.in silico     241 TATTTGCTGGCCGGCGCTGTACTCTCCGCACCCGGCGACAAGAAACTGACGCTGCAAACC 300


16804R-2.IR_full       301 GGTTTCCAGGTGCAGGNAGACAGCCAGCTAACCGTGGGTGCGGGTTTGGGCAGTTCCGCC 360
                           |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
16804R-2.in silico     301 GGTTTCCAGGTGCAGGTAGACAGCCAGCTAACCGTGGGTGCGGGTTTGGGCAGTTCCGCC 360


16804R-2.IR_full       361 TCTTTCGGAGCAGCTTTGGCCACGACATTTCTCATTTTGGCCGGACACTTTGATAGAGAC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16804R-2.in silico     361 TCTTTCGGAGCAGCTTTGGCCACGACATTTCTCATTTTGGCCGGACACTTTGATAGAGAC 420


16804R-2.IR_full       421 AGCTACTTGTCGGAGGCAAACCAGGCGTTGATCTCGTCCTGGGCTTATGAATCGGAGCGT 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16804R-2.in silico     421 AGCTACTTGTCGGAGGCAAACCAGGCGTTGATCTCGTCCTGGGCTTATGAATCGGAGCGT 480


16804R-2.IR_full       481 GTTAATCATGGCACGCCCTC 500
                           ||||||||||||||||||||
16804R-2.in silico     481 GTTAATCATGGCACGCCCTC 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_001032242.1  CG33672-RA, transcript variant A (CG33672), mRNA 
100   482  NM_001032241.1  CG33671-RA, transcript variant A (CG33671), mRNA 
100   482  NM_136958.4  CG12372-RA (spt4), mRNA 
0   NM_170566.1  CG1856-RE, transcript variant E (ttk), mRNA 
0   NM_170565.1  CG1856-RB, transcript variant B (ttk), mRNA 
0   NM_170564.1  CG1856-RA, transcript variant A (ttk), mRNA 
0   NM_139528.2  CG17569-RB, transcript variant B (gry), mRNA 
0   NM_168000.1  CG17569-RA, transcript variant A (gry), mRNA 
0   NM_142844.1  CG7031-RA (CG7031), mRNA 
0   NM_136598.2  CG8196-RA (Ance-4), mRNA 
0   NM_137483.1  CG17527-RA (GstE5), mRNA 
0   NM_080134.2  CG2216-RA, transcript variant A (Fer1HCH), mRNA 
0   NM_170480.1  CG2216-RC, transcript variant C (Fer1HCH), mRNA 
0   NM_170481.1  CG2216-RD, transcript variant D (Fer1HCH), mRNA 
0   NM_170482.1  CG2216-RE, transcript variant E (Fer1HCH), mRNA 
0   NM_170479.1  CG2216-RB, transcript variant B (Fer1HCH), mRNA 
0   NM_001042836.1  CG41105-RA, transcript variant A (CG41105), mRNA 
0   NM_001042835.1  CG41105-RB, transcript variant B (CG41105), mRNA 
0   NM_132584.2  CG32654-RC (CG32654), mRNA 
0   NM_169843.1  CG31222-RA (CG31222), mRNA 
0   NM_134940.1  CG15414-RA (CG15414), mRNA 
0   NM_001043093.1  CG14505-RB (CG14505), mRNA 
0   NM_169273.1  CG8129-RA, transcript variant A (CG8129), mRNA 
0   NM_141629.2  CG8129-RB, transcript variant B (CG8129), mRNA 
0   NM_165290.1  CG17544-RB, transcript variant B (CG17544), mRNA 
0   NM_136117.2  CG17544-RA, transcript variant A (CG17544), mRNA 
0   NM_165291.1  CG17544-RC, transcript variant C (CG17544), mRNA 
0   11  NM_080207.2  CG8402-RA, transcript variant A (PpD3), mRNA 
0   11  NM_169307.1  CG8402-RB, transcript variant B (PpD3), mRNA 
0   10  NM_166178.2  CG4700-RC, transcript variant C (Sema-2a), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.