National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 16742R-3 
 Symbol CG16742  Full Name CG16742 
 CG No CG16742  Old CG No CG16742 
 Synonyms CG16742 
 Accession No (Link to NCBI) NM_137652.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal semi-lethal 
 Map Viewer
 Reference
[Please submit your publication]
Verboon JM, Decker JR, Nakamura M, Parkhurst SM.
Wash exhibits context-dependent phenotypes and, along with the WASH regulatory complex, regulates Drosophila oogenesis.
J. Cell. Sci. (2018) 131(8) [ PubMed ID = 29549166 ] [ RRC reference ]

Yano H, Yamamoto-Hino M, Awano W, Aoki-Kinoshita KF, Tsuda-Sakurai K, Okano H, Goto S.
Identification of proteasome components required for apical localization of Chaoptin using functional genomics.
J. Neurogenet. (2012) 26(1) 53-63 [ PubMed ID = 22417167 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAAGTATGCCGGGTTGTATGAC 
 Primer Seq. 3'
aatctagaggtaccATCTCAGCCTCCTTCGGAGTT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AAGTATGCCG GGTTGTATGA CAGTAAGGAG AATAGTGAAG ATGACAGATC CGAGGAATTC 
0061 TCCTCAAGCT CATCGGACGA GAAGGAACCC GAGACCAAAA AAATAGCAAC GCCAGCGAAC 
0121 AAATTAGAAG AACAGCATCT GTCTGACTCC TCTTCCCTAG CCTCGTTTGC CAGGGAACCG 
0181 GCAATCGTGT CGCCAGTCAT TAACCCTGCT GTTCAGGTAG CAGAGCCTGT CATCAGAACA 
0241 CAACCGCGTC CAATTATAAG CAGTCAAAGG AATCCACATG AGAGGGACAT GTTTGCTGCA 
0301 CTCCGGCAAT CGCCGCCTAG CGACGACCCG CCATCCACAT CGTCATCGCC TACATCTTCA 
0361 CCAGCCTTTA GGAATCCATC AAGTCGCCTT CCAATCGTAT CTACTGCATC GCTTTAGTTC 
0421 CAGTAGCAGT AGTCCTGCCC AACAACCTCC TCGACTCTTC GACGAAGCTG TTTCAACCCA 
0481 AACTCCGAAG GAGGCNTGAG AT 
 in silico PCR Fragment
0001 AAGTATGCCG GGTTGTATGA CAGTAAGGAG AATAGTGAAG ATGACAGATC CGAGGAATTC 
0061 TCCTCAAGCT CATCGGACGA AAAGGAACCC GAGACCAAAA AAATAGCAAC GCCAGCGAAC 
0121 AAATTAGAAG AACAGCATCT GTCTGACTCC TCTTCCCTAG CCTCGTTTGC CAGGGAACCG 
0181 GCAATCGTGT CGCCAGTCAT TAACCCTGCT GTTCAGGTAG CAGAGCCTGT CATCAGAACA 
0241 CAACCGCGTC CAATTATAAA CAGTCAAAGG AATCCACATG AGAGGGACAT GTTTGCTGCC 
0301 CTCCGGCAAT CGCCGCCTAG CGACGACCCG CCATCCACAT CGTCATCGCC TACATCTTCA 
0361 CCAGCCTTTA GGAATCCATC AAGTCGCCTT CCAATCGTAT CTACTGCATC GC-TTAGTTC 
0421 CAGTAGCAGT AGTCCTGCCC AACAACCTCC TCGACTCTTC GACGAAGCTG TTTCAACCCA 
0481 AACTCCGAAG GAGGC-TGAG AT 
 Assemble Data

16742R-3.IR_full       1   AAGTATGCCGGGTTGTATGACAGTAAGGAGAATAGTGAAGATGACAGATCCGAGGAATTC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16742R-3.in silico     1   AAGTATGCCGGGTTGTATGACAGTAAGGAGAATAGTGAAGATGACAGATCCGAGGAATTC 60


16742R-3.IR_full       61  TCCTCAAGCTCATCGGACGAGAAGGAACCCGAGACCAAAAAAATAGCAACGCCAGCGAAC 120
                           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
16742R-3.in silico     61  TCCTCAAGCTCATCGGACGAAAAGGAACCCGAGACCAAAAAAATAGCAACGCCAGCGAAC 120


16742R-3.IR_full       121 AAATTAGAAGAACAGCATCTGTCTGACTCCTCTTCCCTAGCCTCGTTTGCCAGGGAACCG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16742R-3.in silico     121 AAATTAGAAGAACAGCATCTGTCTGACTCCTCTTCCCTAGCCTCGTTTGCCAGGGAACCG 180


16742R-3.IR_full       181 GCAATCGTGTCGCCAGTCATTAACCCTGCTGTTCAGGTAGCAGAGCCTGTCATCAGAACA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16742R-3.in silico     181 GCAATCGTGTCGCCAGTCATTAACCCTGCTGTTCAGGTAGCAGAGCCTGTCATCAGAACA 240


16742R-3.IR_full       241 CAACCGCGTCCAATTATAAGCAGTCAAAGGAATCCACATGAGAGGGACATGTTTGCTGCA 300
                           ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| 
16742R-3.in silico     241 CAACCGCGTCCAATTATAAACAGTCAAAGGAATCCACATGAGAGGGACATGTTTGCTGCC 300


16742R-3.IR_full       301 CTCCGGCAATCGCCGCCTAGCGACGACCCGCCATCCACATCGTCATCGCCTACATCTTCA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16742R-3.in silico     301 CTCCGGCAATCGCCGCCTAGCGACGACCCGCCATCCACATCGTCATCGCCTACATCTTCA 360


16742R-3.IR_full       361 CCAGCCTTTAGGAATCCATCAAGTCGCCTTCCAATCGTATCTACTGCATCGCTTTAGTTC 420
                           |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
16742R-3.in silico     361 CCAGCCTTTAGGAATCCATCAAGTCGCCTTCCAATCGTATCTACTGCATCGC-TTAGTTC 420


16742R-3.IR_full       421 CAGTAGCAGTAGTCCTGCCCAACAACCTCCTCGACTCTTCGACGAAGCTGTTTCAACCCA 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16742R-3.in silico     421 CAGTAGCAGTAGTCCTGCCCAACAACCTCCTCGACTCTTCGACGAAGCTGTTTCAACCCA 480


16742R-3.IR_full       481 AACTCCGAAGGAGGCNTGAGAT 502
                           ||||||||||||||| ||||||
16742R-3.in silico     481 AACTCCGAAGGAGGC-TGAGAT 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_137652.2  CG16742-RA, transcript variant A (CG16742), mRNA 
0   NM_143018.2  CG5794-RD, transcript variant D (CG5794), mRNA 
0   NM_170158.1  CG5794-RB, transcript variant B (CG5794), mRNA 
0   NM_206564.1  CG5794-RE, transcript variant E (CG5794), mRNA 
0   NM_079858.3  CG12070-RA, transcript variant A (Sap-r), mRNA 
0   NM_170529.2  CG12070-RB, transcript variant B (Sap-r), mRNA 
0   NM_142374.2  CG5823-RA (CG5823), mRNA 
0   NM_130536.1  CG14625-RB (CG14625), mRNA 
0   NM_143637.3  CG1937-RA (sip3), mRNA 
0   NM_168210.1  CG8582-RA, transcript variant A (Sh3beta), mRNA 
0   NM_139855.2  CG8582-RB, transcript variant B (Sh3beta), mRNA 
0   NM_140709.1  CG13724-RA (CG13724), mRNA 
0   NM_078794.2  CG9564-RA (Try29F), mRNA 
0   NM_165738.1  CG2269-RC, transcript variant C (CG2269), mRNA 
0   NM_136709.2  CG2269-RA, transcript variant A (CG2269), mRNA 
0   NM_165737.1  CG2269-RB, transcript variant B (CG2269), mRNA 
0   10  NM_140223.1  CG14137-RA (CG14137), mRNA 
0   NM_079979.2  CG18497-RB, transcript variant B (spen), mRNA 
0   NM_164374.1  CG18497-RA, transcript variant A (spen), mRNA 
0   NM_164375.1  CG18497-RC, transcript variant C (spen), mRNA 
0   NM_079290.2  CG6721-RA, transcript variant A (Gap1), mRNA 
0   NM_168382.1  CG6721-RB, transcript variant B (Gap1), mRNA 
0   NM_168099.1  CG32234-RA (CG32234), mRNA 
0   NM_176460.1  CG31374-RC, transcript variant C (CG31374), mRNA 
0   NM_169390.2  CG31374-RB, transcript variant B (CG31374), mRNA 
0   NM_080258.2  CG10229-RA (katanin-60), mRNA 
0   NM_169391.1  CG31374-RA, transcript variant A (CG31374), mRNA 
0   NM_135604.2  CG12299-RA (CG12299), mRNA 
0   NM_057490.3  CG6702-RA (Cbp53E), mRNA 
0   NM_176700.1  CG3035-RA (cm), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
++ 
DM
 
VM
 
VB
 
Caspase-3 signal
N
DB
DC
++ 
DM
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.