National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notification of resumption of orders:

Orders have been suspended as a response to the COVID-19 infection, but it will be resumed today, May 11. However, we would like to set our organizational framework that prioritizes the maintenance of stocks for the time being. In addition, due to delays in delivery of postal items, it is expected that the flies you ordered will not reach you in normal period. We apologize for the inconvenience.

Thank you for your understanding.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 16717R-2 
 Symbol CG16717  Full Name CG16717 
 CG No CG16717  Old CG No CG16717 
 Synonyms CG16717 
 Accession No (Link to NCBI) NM_140086.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGTGCCAGTACATCCACTTAGC 
 Primer Seq. 3'
aatctagaggtaccTCATCCTCCAAATACCGACAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 NTGCCAGTAC ATCCACTTAG CCAGGATCCC ACGGCCGCTT GGAGGGAGAT TAGCAAAACG 
0061 CAGCGNGtGN TCAAGGTGAC AATGAAGCCA CCGACCACCA CGGTgGCGCC CAACAAGGCA 
0121 CGAGTGGTTT GCATGTCCGA CACGCACTCC CTGACGCCCT ACATCAAGTT CGATATACCA 
0181 GATGGCGATA TATTCATACA TGCCGGCGAT TTTACCAAGT GCGGCCAACT GGAGGAGGTG 
0241 GAGGAGTTTA ACACCTGGAT TGGAGCACTG CCCCATCGCC ACAAGATCGT GATTGCTGGC 
0301 AATCATGAGC TCAGCTTCGA TAGAACCTTC ACCCATCCTT TCCAGAAGAG CAAAAGTCAT 
0361 GCTTCGAGCA GCAAACACAC CGGCATGTCC ATCCTCGATG ATCTGCCCAC TTTgGGCAAC 
0421 GCCAAGGAGA ACTTGGAGAG CGCTGTGCAA ACGCAGAATG TCCGCGATGT TCTGACCAAC 
0481 TGTCGGTATT TGGAGGATGA  
 in silico PCR Fragment
0001 GTGCCAGTAC ATCCACTTAG CCAGGATCCC ACGGCCGCTT GGAGGGAGAT TAGCAAAACG 
0061 CAGCGCGTGA TCAAGGTGAC AATGAAGCCA CCGACCACCA CGGTGGCGCC CAACAAGGCA 
0121 CGAGTGGTTT GCATGTCCGA CACGCACTCC CTGACGCCCT ACATCAAGTT CGATATACCA 
0181 GATGGCGATA TATTCATACA TGCCGGCGAT TTTACCAAGT GCGGCCAACT GGAGGAGGTG 
0241 GAGGAGTTTA ACACCTGGAT TGGAGCACTG CCCCATCGCC ACAAGATCGT GATTGCTGGC 
0301 AATCATGAGC TCAGCTTCGA TAGAACCTTC ACCCATCCTT TCCAGAAGAG CAAAAGTCAT 
0361 GCTTCGAGCA GCAAACACAC CGGCATGTCC ATCCTCGATG ATCTGCCCAC TTTGGGCAAC 
0421 GCCAAGGAGA ACTTGGAGAG CGCTGTGCAA ACGCAGAATG TCCGCGATGT TCTGACCAAC 
0481 TGTCGGTATT TGGAGGATGA  
 Assemble Data

16717R-2.IR_full        1   TGCCAGTACATCCACTTAGCCAGGATCCCACGGCCGCTTGGAGGGAGATTAGCAAAACG 59
                            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16717R-2.in silico      1   TGCCAGTACATCCACTTAGCCAGGATCCCACGGCCGCTTGGAGGGAGATTAGCAAAACG 59


16717R-2.IR_full       61  CAGCGNGTGNTCAAGGTGACAATGAAGCCACCGACCACCACGGTGGCGCCCAACAAGGCA 119
                           ||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||
16717R-2.in silico     61  CAGCGCGTGATCAAGGTGACAATGAAGCCACCGACCACCACGGTGGCGCCCAACAAGGCA 119


16717R-2.IR_full       121 CGAGTGGTTTGCATGTCCGACACGCACTCCCTGACGCCCTACATCAAGTTCGATATACCA 179
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16717R-2.in silico     121 CGAGTGGTTTGCATGTCCGACACGCACTCCCTGACGCCCTACATCAAGTTCGATATACCA 179


16717R-2.IR_full       181 GATGGCGATATATTCATACATGCCGGCGATTTTACCAAGTGCGGCCAACTGGAGGAGGTG 239
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16717R-2.in silico     181 GATGGCGATATATTCATACATGCCGGCGATTTTACCAAGTGCGGCCAACTGGAGGAGGTG 239


16717R-2.IR_full       241 GAGGAGTTTAACACCTGGATTGGAGCACTGCCCCATCGCCACAAGATCGTGATTGCTGGC 299
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16717R-2.in silico     241 GAGGAGTTTAACACCTGGATTGGAGCACTGCCCCATCGCCACAAGATCGTGATTGCTGGC 299


16717R-2.IR_full       301 AATCATGAGCTCAGCTTCGATAGAACCTTCACCCATCCTTTCCAGAAGAGCAAAAGTCAT 359
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16717R-2.in silico     301 AATCATGAGCTCAGCTTCGATAGAACCTTCACCCATCCTTTCCAGAAGAGCAAAAGTCAT 359


16717R-2.IR_full       361 GCTTCGAGCAGCAAACACACCGGCATGTCCATCCTCGATGATCTGCCCACTTTGGGCAAC 419
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16717R-2.in silico     361 GCTTCGAGCAGCAAACACACCGGCATGTCCATCCTCGATGATCTGCCCACTTTGGGCAAC 419


16717R-2.IR_full       421 GCCAAGGAGAACTTGGAGAGCGCTGTGCAAACGCAGAATGTCCGCGATGTTCTGACCAAC 479
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16717R-2.in silico     421 GCCAAGGAGAACTTGGAGAGCGCTGTGCAAACGCAGAATGTCCGCGATGTTCTGACCAAC 479


16717R-2.IR_full       481 TGTCGGTATTTGGAGGATGA 499
                           ||||||||||||||||||||
16717R-2.in silico     481 TGTCGGTATTTGGAGGATGA 499

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_140086.1  CG16717-RA (CG16717), mRNA 
0.2   NM_167470.1  CG18102-RD, transcript variant D (shi), mRNA 
0.2   NM_206742.1  CG18102-RG, transcript variant G (shi), mRNA 
0.2   NM_206745.2  CG18102-RA, transcript variant A (shi), mRNA 
0.2   NM_206743.1  CG18102-RF, transcript variant F (shi), mRNA 
0.2   NM_206744.2  CG18102-RE, transcript variant E (shi), mRNA 
0.2   NM_001042813.1  CG18102-RH, transcript variant H (shi), mRNA 
0.2   NM_167471.3  CG18102-RB, transcript variant B (shi), mRNA 
0.2   NM_001042814.1  CG18102-RI, transcript variant I (shi), mRNA 
0.2   NM_080114.3  CG18102-RC, transcript variant C (shi), mRNA 
0   NM_141388.2  CG1249-RA (CG1249), mRNA 
0   12  NM_167620.2  CG32547-RA (CG32547), mRNA 
0   NM_078803.1  CG4105-RA (Cyp4e3), mRNA 
0   NM_131930.1  CG15572-RA (CG15572), mRNA 
0   NM_132909.1  CG9782-RA (CG9782), mRNA 
0   NM_143114.1  CG10514-RA (CG10514), mRNA 
0   NM_133117.2  CG7406-RA (CG7406), mRNA 
0   NM_132521.2  CG1578-RA (CG1578), mRNA 
0   NM_143459.1  CG1964-RA (Kul), mRNA 
0   NM_170139.1  CG31132-RA (BRWD3), mRNA 
0   NM_057604.3  CG1825-RA (Map60), mRNA 
0   NM_135400.1  CG9287-RA (CG9287), mRNA 
0   NM_135281.1  CG6630-RA (CG6630), mRNA 
0   NM_142448.2  CG8064-RA (CG8064), mRNA 
0   NM_176223.2  CG30115-RD, transcript variant D (CG30115), mRNA 
0   NM_132066.1  CG4320-RA (raptor), mRNA 
0   NM_079352.2  CG3329-RA (Prosbeta2), mRNA 
0   NM_079222.2  CG8339-RA (sfl), mRNA 
0   NM_132317.1  CG12121-RA (CG12121), mRNA 
0   NM_169939.1  CG5670-RD, transcript variant D (Atpalpha), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.