National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notification of resumption of orders:

Orders have been suspended as a response to the COVID-19 infection, but it will be resumed today, May 11. However, we would like to set our organizational framework that prioritizes the maintenance of stocks for the time being. In addition, due to delays in delivery of postal items, it is expected that the flies you ordered will not reach you in normal period. We apologize for the inconvenience.

Thank you for your understanding.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 16711R-3 
 Symbol CG16711  Full Name CG16711 
 CG No CG16711  Old CG No CG16711 
 Synonyms CG16711 
 Accession No (Link to NCBI) NM_140090.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCTGCTGCTAGCCAGGATGAG 
 Primer Seq. 3'
aatctagaggtaccGCTGTGGATGTGACGTGCGTT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GCTGCTGCTA GCCAGGATGA GCCGGAGGNG AAGTGCGAAT AACAACAATA ATCCCACAGC 
0061 AACAACAACA ACAATTAACG GAGGGCATCA TCAAGCAGGA AACTGGAGGC CGCTCCCGCC 
0121 GGTTTGCCAC CGAAAATCGG AGCGCCGGAG AGTGGCCCGT GATATATTCC TGGTCTTCGA 
0181 GGAGCAGACC ACCCGGCGAC GAGGGAAGGG AGCACGGGGC AAGGCCACAA GGGCAAAGCA 
0241 AAAGTTCGGA CACCTGAAGG TGGCCAATAC GCCGCGCATC AATAAGAATG TGCTGCGCGA 
0301 CATTAAAACG GAACCAAAGT GCAGCTCGGA AGCCGTTGTG CCGGCTGCTG CCCCAGCTAT 
0361 CACACCCATT CCCGCACTGA ATCCCCCAAT TCCTCCGCAA ATAGCCGCGC TCAATCCTCC 
0421 GTTGCCGGAG GAGCCGACGT TAGCCAAATC CTTGCCGCGA ACgGCGGCCG TAAAATTGGA 
0481 AACCAAAACG CACGTCACAT CCACAGC 
 in silico PCR Fragment
0001 GCTGCTGCTA GCCAGGATGA GCCGGAGGCG -AGTGCGAAT AACAACAATA AT--CACAGC 
0061 AACAACAACA ACAA-TAAC- GAGGGCATCA TCAAGCAGG- AACTGGAGGC CGCT-CCGCC 
0121 GGTTTGCCAC CGAAAATCGG AGCGCCGGAG AGTGGCCCGT GATATATTCC TGGTCTTCGA 
0181 GGAGCAGACC ACCCGGCGAC GAGGGAAGGG AGCACGGGGC AAGGCCACAA GGGCAAAGCA 
0241 AAAGTTCGGA CACCTGAAGG TGGCCAATAC GCCGCGCATC AATAAGAATG TGCTGCGCGA 
0301 CATTAAAACG GAACCAAAGT GCAGCTCGGA AGCCGTTGTG CCGGCTGCTG CCCCAGCTAT 
0361 CACACCCATT CCCGCACTGA ATCCCCCAAT TCCTCCGCAA ATAGCCGCGC TCAATCCTCC 
0421 GTTGCCGGAG GAGCCGACGT TAGCCAAATC CTTGCCGCGA ACGGCGGCCG TAAAATTGGA 
0481 AACCAAAACG CACGTCACAT CCACAGC 
 Assemble Data

16711R-3.IR_full       1   GCTGCTGCTAGCCAGGATGAGCCGGAGGNGAAGTGCGAATAACAACAATAATCCCACAGC 60
                           |||||||||||||||||||||||||||| | |||||||||||||||||||||  ||||||
16711R-3.in silico     1   GCTGCTGCTAGCCAGGATGAGCCGGAGGCG-AGTGCGAATAACAACAATAAT--CACAGC 60


16711R-3.IR_full       61  AACAACAACAACAATTAACGGAGGGCATCATCAAGCAGGAAACTGGAGGCCGCTCCCGCC 120
                           |||||||||||||| |||| ||||||||||||||||||| |||||||||||||| |||||
16711R-3.in silico     61  AACAACAACAACAA-TAAC-GAGGGCATCATCAAGCAGG-AACTGGAGGCCGCT-CCGCC 120


16711R-3.IR_full       121 GGTTTGCCACCGAAAATCGGAGCGCCGGAGAGTGGCCCGTGATATATTCCTGGTCTTCGA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16711R-3.in silico     121 GGTTTGCCACCGAAAATCGGAGCGCCGGAGAGTGGCCCGTGATATATTCCTGGTCTTCGA 180


16711R-3.IR_full       181 GGAGCAGACCACCCGGCGACGAGGGAAGGGAGCACGGGGCAAGGCCACAAGGGCAAAGCA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16711R-3.in silico     181 GGAGCAGACCACCCGGCGACGAGGGAAGGGAGCACGGGGCAAGGCCACAAGGGCAAAGCA 240


16711R-3.IR_full       241 AAAGTTCGGACACCTGAAGGTGGCCAATACGCCGCGCATCAATAAGAATGTGCTGCGCGA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16711R-3.in silico     241 AAAGTTCGGACACCTGAAGGTGGCCAATACGCCGCGCATCAATAAGAATGTGCTGCGCGA 300


16711R-3.IR_full       301 CATTAAAACGGAACCAAAGTGCAGCTCGGAAGCCGTTGTGCCGGCTGCTGCCCCAGCTAT 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16711R-3.in silico     301 CATTAAAACGGAACCAAAGTGCAGCTCGGAAGCCGTTGTGCCGGCTGCTGCCCCAGCTAT 360


16711R-3.IR_full       361 CACACCCATTCCCGCACTGAATCCCCCAATTCCTCCGCAAATAGCCGCGCTCAATCCTCC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16711R-3.in silico     361 CACACCCATTCCCGCACTGAATCCCCCAATTCCTCCGCAAATAGCCGCGCTCAATCCTCC 420


16711R-3.IR_full       421 GTTGCCGGAGGAGCCGACGTTAGCCAAATCCTTGCCGCGAACGGCGGCCGTAAAATTGGA 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16711R-3.in silico     421 GTTGCCGGAGGAGCCGACGTTAGCCAAATCCTTGCCGCGAACGGCGGCCGTAAAATTGGA 480


16711R-3.IR_full       481 AACCAAAACGCACGTCACATCCACAGC 507
                           |||||||||||||||||||||||||||
16711R-3.in silico     481 AACCAAAACGCACGTCACATCCACAGC 507

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  38  NM_168361.1  CG16711-RB, transcript variant B (CG16711), mRNA 
100   482  38  NM_140090.1  CG16711-RA, transcript variant A (CG16711), mRNA 
0.82   11  27  NM_079861.2  CG1455-RA (CanA1), mRNA 
0.62   14  70  171  NM_132370.1  CG2989-RA (CG2989), mRNA 
0.62   13  18  33  NM_143443.2  CG11470-RA (CG11470), mRNA 
0.62   12  23  NM_166441.2  CG30387-RB, transcript variant B (CG30387), mRNA 
0.62   12  22  NM_137730.2  CG30387-RA, transcript variant A (CG30387), mRNA 
0.62   12  22  NM_166442.2  CG30387-RC, transcript variant C (CG30387), mRNA 
0.62   21  NM_169778.1  CG31246-RA (CG31246), mRNA 
0.62   13  27  NM_078663.2  CG5529-RA (B-H1), mRNA 
0.62   15  NM_167373.1  CG32629-RA (CG32629), mRNA 
0.41   28  42  NM_142444.1  CG18599-RA (CG18599), mRNA 
0.41   12  NM_132655.1  CG1662-RA (CG1662), mRNA 
0.41   24  NM_143154.3  CG5053-RA (CG5053), mRNA 
0.41   10  NM_166991.2  CG32779-RA (CG32779), mRNA 
0.41   26  NM_001032244.1  CG32904-RA, transcript variant A (seq), mRNA 
0.41   28  NM_078660.2  CG5424-RB, transcript variant B (f), mRNA 
0.41   28  NM_001042819.1  CG5424-RF, transcript variant F (f), mRNA 
0.41   28  NM_176745.1  CG5424-RD, transcript variant D (f), mRNA 
0.41   26  NM_176746.1  CG5424-RC, transcript variant C (f), mRNA 
0.2   16  52  103  NM_079002.2  CG3905-RA (Su(z)2), mRNA 
0.2   15  56  150  NM_078592.2  CG11172-RA (NFAT), mRNA 
0.2   12  50  139  NM_169786.1  CG7847-RB, transcript variant B (sr), mRNA 
0.2   12  49  137  NM_079671.2  CG7847-RA, transcript variant A (sr), mRNA 
0.2   12  33  48  NM_132161.4  CG1659-RA (unc-119), mRNA 
0.2   11  27  48  NM_168964.2  CG11352-RB, transcript variant B (jim), mRNA 
0.2   11  27  48  NM_143699.2  CG11352-RC, transcript variant C (jim), mRNA 
0.2   10  37  70  NM_137212.2  CG30089-RA (CG30089), mRNA 
0.2   51  179  NM_167335.1  CG4013-RC, transcript variant C (Smr), mRNA 
0.2   51  179  NM_167334.1  CG4013-RB, transcript variant B (Smr), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
+- 
DC
+- 
DM
+- 
VM
 
VB
 
Caspase-3 signal
N
++ 
DB
++ 
DC
++ 
DM
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.