National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1666R-2 
 Symbol Hlc  Full Name Helicase 
 CG No CG1666  Old CG No CG1666 
 Synonyms HLC, DmRH10, hlc, A112, l(1)A112, HM-44, 11P1, l(1)11P1, unnamed, lA112, l11P1, 14, 7, l(1)S-19F6, l(1)8-1, l(1)19Ff, CG1666, Hlc 
 Accession No (Link to NCBI) NM_078710.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Ohhara Y, Hoshino G, Imahori K, Matsuyuki T, Yamakawa-Kobayashi K.
The Nutrient-Responsive Molecular Chaperone Hsp90 Supports Growth and Development in Drosophila.
Front Physiol (2021) 12 690564 [ PubMed ID = 34239451 ] [ RRC reference ]

Ohhara Y, Nakamura A, Kato Y, Yamakawa-Kobayashi K.
Chaperonin TRiC/CCT supports mitotic exit and entry into endocycle in Drosophila.
PLoS Genet (2019) 15(4) e1008121 [ PubMed ID = 31034473 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   ACCGCTGCTTCTGGAGGGCAAGGATGTGGTGGTGCGCGCCCGCACCGGATCCGGCAAGAC 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  TGCCACCTACGCCCTGCCACTGATTCAGAAGATCCTTAACTCCAAACTGAACGCCAGCGA 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GCAGTATGTGAGCGCTGTGGTCCTGGCGCCCACCAAGGAGCTATGCCGGCAGTCCCGTAA 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GGTGATCGAGCAGCTGGTCGAGTCCTGCGGCAAGGTTGTACGCGTGGCGGACATTGCCGA 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 TAGCTCCAACGACACGGTGACCCAGCGGCACGCCTTGTCTGAAAGTCCCGACATTGTGGT 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 TGCCACACCCGCCAATTTGCTGGCCTACGCCGAGGCTGGTAGCGTGGTGGATCTGAAGCA 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 TGTGGAGACCTTGGTGGTGGACGAGGCGGATCTGGTGTTTGCCTATGGCTACGAAAAGGA 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 CTTCAAGCGGTTGATTAAGCACCTGCCTCCCATCTACCAGGCTGTCCTAGTCTCCGCTAC 480

1666R-2.IR_full       481 TCTAACCGACGATGTGGTGC 500
                          |||||||||||||||||||| silico     481 TCTAACCGACGATGTGGTGC 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_078710.2  CG1666-RA (Hlc), mRNA 
0.41   NM_132025.2  CG3125-RA, transcript variant A (l(1)G0060), mRNA 
0.41   NM_167047.1  CG3125-RB, transcript variant B (l(1)G0060), mRNA 
0   NM_139990.2  CG5971-RA (CG5971), mRNA 
0   NM_144347.2  CG12149-RA (c12.2), mRNA 
0   NM_137418.2  CG5002-RA (CG5002), mRNA 
0   NM_140405.1  CG10710-RA (CG10710), mRNA 
0   NM_167149.1  CG2151-RB, transcript variant B (Trxr-1), mRNA 
0   NM_206198.1  CG9294-RB, transcript variant B (CG9294), mRNA 
0   NM_137772.1  CG9294-RA, transcript variant A (CG9294), mRNA 
0   NM_166146.1  CG8428-RB, transcript variant B (spin), mRNA 
0   NM_166144.1  CG8428-RC, transcript variant C (spin), mRNA 
0   NM_080084.2  CG8428-RD, transcript variant D (spin), mRNA 
0   NM_166145.1  CG8428-RA, transcript variant A (spin), mRNA 
0   NM_166147.1  CG8428-RE, transcript variant E (spin), mRNA 
0   NM_170147.1  CG6798-RB, transcript variant B (nAcRbeta-96A), mRNA 
0   NM_079759.2  CG6798-RA, transcript variant A (nAcRbeta-96A), mRNA 
0   NM_134744.1  CG14342-RA (CG14342), mRNA 
0   NM_143025.1  CG13632-RA (CG13632), mRNA 
0   12  NM_165306.1  CG10186-RC, transcript variant C (CG10186), mRNA 
0   12  NM_136134.4  CG10186-RA, transcript variant A (CG10186), mRNA 
0   12  NM_132068.1  CG15899-RB (Ca-alpha1T), mRNA 
0   NM_130544.3  CG14622-RA, transcript variant A (DAAM), mRNA 
0   NM_166875.1  CG14622-RC, transcript variant C (DAAM), mRNA 
0   NM_166876.1  CG14622-RB, transcript variant B (DAAM), mRNA 
0   NM_130504.2  CG16989-RA (CG16989), mRNA 
0   NM_132366.2  CG15251-RA (CG15251), mRNA 
0   NM_001038883.1  CG33988-RA (CG33988), mRNA 
0   NM_132200.1  CG1531-RB (CG1531), mRNA 
0   NM_176386.1  CG11489-RC, transcript variant C (CG11489), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.