National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1666R-1 
 Symbol Hlc  Full Name Helicase 
 CG No CG1666  Old CG No CG1666 
 Synonyms HLC, DmRH10, hlc, A112, l(1)A112, HM-44, 11P1, l(1)11P1, unnamed, lA112, l11P1, 14, 7, l(1)S-19F6, l(1)8-1, l(1)19Ff, CG1666, Hlc 
 Accession No (Link to NCBI) NM_078710.2 
 Inserted Chr.
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACCGCTGCTTCTGGAGGGCAA 
 Primer Seq. 3'
aatctagaggtaccGCACCACATCGTCGGTTAGAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ACCGCTGCTT CTGGAGGGCA AGGATGTGGT GGTGCGCGCC CGCACCGGAT CCGGCAAGAC 
0061 TGCCACCTAC GCCCTGCCAC TGATTCAGAA GATCCTTAAC TCCAAACTGA ACGCCAGCGA 
0121 GCAGTATGTG AGCGCTGTGG TCCTGGCGCC CACCAAGGAG CTATGCCGGC AGTCCCGTAA 
0181 GGTGATCGAG CAGCTGGTCG AGTCCTGCGG CAAGGTTGTA CGCGTGGCGG ACATTGCCGA 
0241 TAGCTCCAAC GACACGGTGA CCCAGCGGCA CGCCTTGTCT GAAAGTCCCG ACATTGTGGT 
0301 TGCCACACCC GCCAATTTGC TGGCCTACGC CGAGGCTGGT AGCGTGGTGG ATCTGAAGCA 
0361 TGTGGAGACC TTGGTGGTGG ACGAGGCGGA TCTGGTGTTT GCCTATGGCT ACGAAAAGGA 
0421 CTTCAAGCGG TTGATTAAGC ACCTGCCTCC CATCTACCAG GCTGTCCTAG TCTCCGCTAC 
0481 TCTAACCGAC GATGTGGTGC  
 in silico PCR Fragment
0001 ACCGCTGCTT CTGGAGGGCA AGGATGTGGT GGTGCGCGCC CGCACCGGAT CCGGCAAGAC 
0061 TGCCACCTAC GCCCTGCCAC TGATTCAGAA GATCCTTAAC TCCAAACTGA ACGCCAGCGA 
0121 GCAGTATGTG AGCGCTGTGG TCCTGGCGCC CACCAAGGAG CTATGCCGGC AGTCCCGTAA 
0181 GGTGATCGAG CAGCTGGTCG AGTCCTGCGG CAAGGTTGTA CGCGTGGCGG ACATTGCCGA 
0241 TAGCTCCAAC GACACGGTGA CCCAGCGGCA CGCCTTGTCT GAAAGTCCCG ACATTGTGGT 
0301 TGCCACACCC GCCAATTTGC TGGCCTACGC CGAGGCTGGT AGCGTGGTGG ATCTGAAGCA 
0361 TGTGGAGACC TTGGTGGTGG ACGAGGCGGA TCTGGTGTTT GCCTATGGCT ACGAAAAGGA 
0421 CTTCAAGCGG TTGATTAAGC ACCTGCCTCC CATCTACCAG GCTGTCCTAG TCTCCGCTAC 
0481 TCTAACCGAC GATGTGGTGC  
 Assemble Data

1666R-1.IR_full       1   ACCGCTGCTTCTGGAGGGCAAGGATGTGGTGGTGCGCGCCCGCACCGGATCCGGCAAGAC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1666R-1.in silico     1   ACCGCTGCTTCTGGAGGGCAAGGATGTGGTGGTGCGCGCCCGCACCGGATCCGGCAAGAC 60


1666R-1.IR_full       61  TGCCACCTACGCCCTGCCACTGATTCAGAAGATCCTTAACTCCAAACTGAACGCCAGCGA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1666R-1.in silico     61  TGCCACCTACGCCCTGCCACTGATTCAGAAGATCCTTAACTCCAAACTGAACGCCAGCGA 120


1666R-1.IR_full       121 GCAGTATGTGAGCGCTGTGGTCCTGGCGCCCACCAAGGAGCTATGCCGGCAGTCCCGTAA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1666R-1.in silico     121 GCAGTATGTGAGCGCTGTGGTCCTGGCGCCCACCAAGGAGCTATGCCGGCAGTCCCGTAA 180


1666R-1.IR_full       181 GGTGATCGAGCAGCTGGTCGAGTCCTGCGGCAAGGTTGTACGCGTGGCGGACATTGCCGA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1666R-1.in silico     181 GGTGATCGAGCAGCTGGTCGAGTCCTGCGGCAAGGTTGTACGCGTGGCGGACATTGCCGA 240


1666R-1.IR_full       241 TAGCTCCAACGACACGGTGACCCAGCGGCACGCCTTGTCTGAAAGTCCCGACATTGTGGT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1666R-1.in silico     241 TAGCTCCAACGACACGGTGACCCAGCGGCACGCCTTGTCTGAAAGTCCCGACATTGTGGT 300


1666R-1.IR_full       301 TGCCACACCCGCCAATTTGCTGGCCTACGCCGAGGCTGGTAGCGTGGTGGATCTGAAGCA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1666R-1.in silico     301 TGCCACACCCGCCAATTTGCTGGCCTACGCCGAGGCTGGTAGCGTGGTGGATCTGAAGCA 360


1666R-1.IR_full       361 TGTGGAGACCTTGGTGGTGGACGAGGCGGATCTGGTGTTTGCCTATGGCTACGAAAAGGA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1666R-1.in silico     361 TGTGGAGACCTTGGTGGTGGACGAGGCGGATCTGGTGTTTGCCTATGGCTACGAAAAGGA 420


1666R-1.IR_full       421 CTTCAAGCGGTTGATTAAGCACCTGCCTCCCATCTACCAGGCTGTCCTAGTCTCCGCTAC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1666R-1.in silico     421 CTTCAAGCGGTTGATTAAGCACCTGCCTCCCATCTACCAGGCTGTCCTAGTCTCCGCTAC 480


1666R-1.IR_full       481 TCTAACCGACGATGTGGTGC 500
                          ||||||||||||||||||||
1666R-1.in silico     481 TCTAACCGACGATGTGGTGC 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_078710.2  CG1666-RA (Hlc), mRNA 
0.41   NM_132025.2  CG3125-RA, transcript variant A (l(1)G0060), mRNA 
0.41   NM_167047.1  CG3125-RB, transcript variant B (l(1)G0060), mRNA 
0   NM_139990.2  CG5971-RA (CG5971), mRNA 
0   NM_144347.2  CG12149-RA (c12.2), mRNA 
0   NM_137418.2  CG5002-RA (CG5002), mRNA 
0   NM_140405.1  CG10710-RA (CG10710), mRNA 
0   NM_167149.1  CG2151-RB, transcript variant B (Trxr-1), mRNA 
0   NM_206198.1  CG9294-RB, transcript variant B (CG9294), mRNA 
0   NM_137772.1  CG9294-RA, transcript variant A (CG9294), mRNA 
0   NM_166146.1  CG8428-RB, transcript variant B (spin), mRNA 
0   NM_166144.1  CG8428-RC, transcript variant C (spin), mRNA 
0   NM_080084.2  CG8428-RD, transcript variant D (spin), mRNA 
0   NM_166145.1  CG8428-RA, transcript variant A (spin), mRNA 
0   NM_166147.1  CG8428-RE, transcript variant E (spin), mRNA 
0   NM_170147.1  CG6798-RB, transcript variant B (nAcRbeta-96A), mRNA 
0   NM_079759.2  CG6798-RA, transcript variant A (nAcRbeta-96A), mRNA 
0   NM_134744.1  CG14342-RA (CG14342), mRNA 
0   NM_143025.1  CG13632-RA (CG13632), mRNA 
0   12  NM_165306.1  CG10186-RC, transcript variant C (CG10186), mRNA 
0   12  NM_136134.4  CG10186-RA, transcript variant A (CG10186), mRNA 
0   12  NM_132068.1  CG15899-RB (Ca-alpha1T), mRNA 
0   NM_130544.3  CG14622-RA, transcript variant A (DAAM), mRNA 
0   NM_166875.1  CG14622-RC, transcript variant C (DAAM), mRNA 
0   NM_166876.1  CG14622-RB, transcript variant B (DAAM), mRNA 
0   NM_130504.2  CG16989-RA (CG16989), mRNA 
0   NM_132366.2  CG15251-RA (CG15251), mRNA 
0   NM_001038883.1  CG33988-RA (CG33988), mRNA 
0   NM_132200.1  CG1531-RB (CG1531), mRNA 
0   NM_176386.1  CG11489-RC, transcript variant C (CG11489), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.