National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1657R-2 
 Symbol CG1657  Full Name CG1657 
 CG No CG1657  Old CG No CG1657 
 Synonyms CG1657 
 Accession No (Link to NCBI)  
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees late pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAGATCATGGACCTGGCCCGCA 
 Primer Seq. 3'
aatctagaggtaccGGGCTGTTCGCTGGTCAGCAA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AGATCATGGA CCTGGCCCGC ACTCTCCGCC NNNAGCAGCT CTTCATCCAG CAGGAGCAGG 
0061 CGGCCTTTGC CCAGCTCACT GGAGCCTTTG AAACCAATGC AGGGACCATA ACCAAGTTGG 
0121 CCTTTGTGTG TGCCCAGCAG CGGCAGATAC TCAATGAGCT GCTCCTGGCG CGCACAGATC 
0181 AGGATCCGCT GCTCTTCTGC CGCCGAGCGA GTGCCTACGA TAGTGCCCAA TTCGTGGACG 
0241 CCAAGCAGTT GCTGCCCTAT GAGCACGCCT TGGCCTACGA AGATCTGTTC AACTACTTGT 
0301 ATAATACACC CTATTTGTTG GCCCTATCCC TGGCCACCGC GGATCGCTTA TCCCTGCTCT 
0361 CGGCCAGCCA GCTTGGCCAA ATTATCAATA CCATAGCGAC GGGACTGTAT GCAATGCCAT 
0421 CAATACCAAG GATGTGGAAC TGCTGCTTAA ATTGCTGCGG GAACTGATTG AAATCCAATT 
0481 GCTGACCAGC GAACAGCC 
 in silico PCR Fragment
0001 AGATCATGGA CCTGGCCCGC ACTCTCCGCC AGGAGCAGCT CTTCATCCAG CAGGAGCAGG 
0061 CGGCCTTTGC CCAGCTCACT GGAGCCTTTG AGAGCAATGC AGGGACCATA ACCAAGTTGG 
0121 CCTTTGTGTG TGCCCAGCAG CGGCAGATAC TCAATGAGCT GCTCCTGGCG CGCACAGATC 
0181 AGGATCCGCT GCTCTTCTGC CGCCGAGCGA GTGCCTACGA TAGTGCCCAA TTCGTGGACG 
0241 CCAAGCAGTT GCTGCCCTAT GAGCACGCCT TGGCCTACGA AGATCTGTTC AACTACTTGT 
0301 ATAATACACC CTATTTGTTG GCCCTATCCC TGGCCACCGC GGATCGCTTA TCCCTGCTCT 
0361 CGGCCAGCCA GCTTGGCCAA ATTATTAATA CCATAGCGAC GGGACTGTAT GGCAATGCCA 
0421 TCAATACCAA GGATGTGGAA CTGCTGCTTA AATTGCTGCG GGAACTGATT GAAATCCAAT 
0481 TGCTGACCAG CGAACAGCCC  
 Assemble Data

1657R-2.IR full       1   AGATCATGGACCTGGCCCGCACTCTCCGCCNNNAGCAGCTCTTCATCCAGCAGGAGCAGG 60
                          ||||||||||||||||||||||||||||||   |||||||||||||||||||||||||||
1657R-2.in silico     1   AGATCATGGACCTGGCCCGCACTCTCCGCCAGGAGCAGCTCTTCATCCAGCAGGAGCAGG 60


1657R-2.IR full       61  CGGCCTTTGCCCAGCTCACTGGAGCCTTTGAAACCAATGCAGGGACCATAACCAAGTTGG 120
                          ||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||
1657R-2.in silico     61  CGGCCTTTGCCCAGCTCACTGGAGCCTTTGAGAGCAATGCAGGGACCATAACCAAGTTGG 120


1657R-2.IR full       121 CCTTTGTGTGTGCCCAGCAGCGGCAGATACTCAATGAGCTGCTCCTGGCGCGCACAGATC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1657R-2.in silico     121 CCTTTGTGTGTGCCCAGCAGCGGCAGATACTCAATGAGCTGCTCCTGGCGCGCACAGATC 180


1657R-2.IR full       181 AGGATCCGCTGCTCTTCTGCCGCCGAGCGAGTGCCTACGATAGTGCCCAATTCGTGGACG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1657R-2.in silico     181 AGGATCCGCTGCTCTTCTGCCGCCGAGCGAGTGCCTACGATAGTGCCCAATTCGTGGACG 240


1657R-2.IR full       241 CCAAGCAGTTGCTGCCCTATGAGCACGCCTTGGCCTACGAAGATCTGTTCAACTACTTGT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1657R-2.in silico     241 CCAAGCAGTTGCTGCCCTATGAGCACGCCTTGGCCTACGAAGATCTGTTCAACTACTTGT 300


1657R-2.IR full       301 ATAATACACCCTATTTGTTGGCCCTATCCCTGGCCACCGCGGATCGCTTATCCCTGCTCT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1657R-2.in silico     301 ATAATACACCCTATTTGTTGGCCCTATCCCTGGCCACCGCGGATCGCTTATCCCTGCTCT 360


1657R-2.IR full       361 CGGCCAGCCAGCTTGGCCAAATTATCAATACCATAGCGACGGGACTGTATG-CAATGCCA 420
                          ||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||
1657R-2.in silico     361 CGGCCAGCCAGCTTGGCCAAATTATTAATACCATAGCGACGGGACTGTATGGCAATGCCA 420


1657R-2.IR full       421 TCAATACCAAGGATGTGGAACTGCTGCTTAAATTGCTGCGGGAACTGATTGAAATCCAAT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1657R-2.in silico     421 TCAATACCAAGGATGTGGAACTGCTGCTTAAATTGCTGCGGGAACTGATTGAAATCCAAT 480


1657R-2.IR full       481 TGCTGACCAGCGAACAGCC- 500
                          ||||||||||||||||||| 
1657R-2.in silico     481 TGCTGACCAGCGAACAGCCC 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.