National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1644R-2 
 Symbol Cyp6t1  Full Name Cyp6t1 
 CG No CG1644  Old CG No CG1644 
 Synonyms 6t1, CG1644, Cyp6t1 
 Accession No (Link to NCBI) NM_134613.2 
 Inserted Chr.
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGGATCCCTCGTTCTGCTCCC 
 Primer Seq. 3'
aatctagaggtaccGCTCCTCGAGCTTCTGTCCAA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TGGATCCCTC GTTCTGCTCC CCGTTGTCCT AAGAGGTGGA TGTCTACTTG TCGTAACAAT 
0061 CGTTTGGCTG TGGCAAATTC TACACTTCTG GCATTGGCGA CGTCTGGGCG TCCCCTTTGT 
0121 TCCGGCTGCC CCATTTGTGG GGAATGTGTG GAACCTTTTG CGCGGAGCCT GCTGCTTTGG 
0181 CGATCAGTTT CGCGAGTTGT ACGAGAGTAA GGAGGCTGCC GGCCGCGCCT TCGTGGGAAT 
0241 TGACGTGCTG CACAATCACG CACTGCTTCT TCGAGATCCG GCTCTGATCA AGCGCATTAT 
0301 GGTGGAAGAC TTCGCTCAGT TCTCGAGCCG CTTTGAGACG ACAGATCCCA CTTGTGACAC 
0361 AATGGGATCG CAGAACCTTT TCTTTTCCAA ATACGAGACT TGGCGGGAGA CGCACAAGAT 
0421 CTTTGCGCCC TTCTTTGCTG CGGGAAAGGT GCGCAATATG TACGGGCTTC TGGAAAACAT 
0481 TGGACAGAAG CTCGAGGAGC  
 in silico PCR Fragment
0001 TGGATCCCTC GTTCTGCTCC CCGTTGTCCT AAGAGGTGGA TGTCTACTTG TCGTAACAAT 
0061 CGTTTGGCTG TGGCAAATTC TACACTTCTG GCATTGGCGA CGTCTGGGCG TCCCCTTTGT 
0121 TCCGGCTGCC CCATTTGTGG GGAATGTGTG GAATCTTTTG CGTGGAGCCT GCTGCTTTGG 
0181 CGATCAGTTT CGCGAGTTGT ACGAGAGTAA GGAGGCTGCC GGCCGCGCCT TCGTGGGAAT 
0241 TGACGTGCTG CACAATCACG CACTGCTTCT TCGAGATCCG GCTCTGATCA AGCGCATTAT 
0301 GGTGGAAGAC TTCGCTCAGT TCTCGAGCCG CTTTGAGACG ACAGATCCCA CTTGTGACAC 
0361 AATGGGATCG CAGAACCTTT TCTTTTCCAA ATACGAGACT TGGCGGGAGA CGCACAAGAT 
0421 CTTTGCGCCC TTCTTTGCTG CGGGAAAGGT GCGCAATATG TACGGGCTTC TGGAAAACAT 
0481 TGGACAGAAG CTCGAGGAGC  
 Assemble Data

1644R-2.IR_full       1   TGGATCCCTCGTTCTGCTCCCCGTTGTCCTAAGAGGTGGATGTCTACTTGTCGTAACAAT 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1644R-2.in silico     1   TGGATCCCTCGTTCTGCTCCCCGTTGTCCTAAGAGGTGGATGTCTACTTGTCGTAACAAT 60


1644R-2.IR_full       61  CGTTTGGCTGTGGCAAATTCTACACTTCTGGCATTGGCGACGTCTGGGCGTCCCCTTTGT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1644R-2.in silico     61  CGTTTGGCTGTGGCAAATTCTACACTTCTGGCATTGGCGACGTCTGGGCGTCCCCTTTGT 120


1644R-2.IR_full       121 TCCGGCTGCCCCATTTGTGGGGAATGTGTGGAACCTTTTGCGCGGAGCCTGCTGCTTTGG 180
                          ||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||
1644R-2.in silico     121 TCCGGCTGCCCCATTTGTGGGGAATGTGTGGAATCTTTTGCGTGGAGCCTGCTGCTTTGG 180


1644R-2.IR_full       181 CGATCAGTTTCGCGAGTTGTACGAGAGTAAGGAGGCTGCCGGCCGCGCCTTCGTGGGAAT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1644R-2.in silico     181 CGATCAGTTTCGCGAGTTGTACGAGAGTAAGGAGGCTGCCGGCCGCGCCTTCGTGGGAAT 240


1644R-2.IR_full       241 TGACGTGCTGCACAATCACGCACTGCTTCTTCGAGATCCGGCTCTGATCAAGCGCATTAT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1644R-2.in silico     241 TGACGTGCTGCACAATCACGCACTGCTTCTTCGAGATCCGGCTCTGATCAAGCGCATTAT 300


1644R-2.IR_full       301 GGTGGAAGACTTCGCTCAGTTCTCGAGCCGCTTTGAGACGACAGATCCCACTTGTGACAC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1644R-2.in silico     301 GGTGGAAGACTTCGCTCAGTTCTCGAGCCGCTTTGAGACGACAGATCCCACTTGTGACAC 360


1644R-2.IR_full       361 AATGGGATCGCAGAACCTTTTCTTTTCCAAATACGAGACTTGGCGGGAGACGCACAAGAT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1644R-2.in silico     361 AATGGGATCGCAGAACCTTTTCTTTTCCAAATACGAGACTTGGCGGGAGACGCACAAGAT 420


1644R-2.IR_full       421 CTTTGCGCCCTTCTTTGCTGCGGGAAAGGTGCGCAATATGTACGGGCTTCTGGAAAACAT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1644R-2.in silico     421 CTTTGCGCCCTTCTTTGCTGCGGGAAAGGTGCGCAATATGTACGGGCTTCTGGAAAACAT 480


1644R-2.IR_full       481 TGGACAGAAGCTCGAGGAGC 500
                          ||||||||||||||||||||
1644R-2.in silico     481 TGGACAGAAGCTCGAGGAGC 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_134613.2  CG1644-RA (Cyp6t1), mRNA 
0   12  46  90  NR_001355.1  CG1644-RA (Cyp6t1), mRNA, mRNA 
0   NM_057545.3  CG14513-RA (yemalpha), mRNA 
0   13  NM_058085.4  CG9765-RC, transcript variant C (tacc), mRNA 
0   13  NM_176401.1  CG9765-RD, transcript variant D (tacc), mRNA 
0   13  NM_176404.1  CG9765-RG, transcript variant G (tacc), mRNA 
0   13  NM_169016.1  CG9765-RB, transcript variant B (tacc), mRNA 
0   13  NM_058086.2  CG9765-RA, transcript variant A (tacc), mRNA 
0   13  NM_176402.1  CG9765-RE, transcript variant E (tacc), mRNA 
0   13  NM_176403.1  CG9765-RF, transcript variant F (tacc), mRNA 
0   NM_143086.2  CG13651-RA (danr), mRNA 
0   NM_078665.2  CG6352-RA (OdsH), mRNA 
0   NM_137949.2  CG9812-RB, transcript variant B (CG9812), mRNA 
0   NM_206371.1  CG7266-RD, transcript variant D (Eip71CD), mRNA 
0   NM_168622.1  CG7266-RB, transcript variant B (Eip71CD), mRNA 
0   NM_166604.1  CG9812-RC, transcript variant C (CG9812), mRNA 
0   NM_136953.2  CG8816-RA (CG8816), mRNA 
0   NM_079361.2  CG7266-RA, transcript variant A (Eip71CD), mRNA 
0   NM_170274.1  CG5455-RC, transcript variant C (CG5455), mRNA 
0   NM_170273.1  CG5455-RB, transcript variant B (CG5455), mRNA 
0   NM_168623.1  CG7266-RC, transcript variant C (Eip71CD), mRNA 
0   NM_143224.2  CG5455-RA, transcript variant A (CG5455), mRNA 
0   NM_057579.3  CG12759-RA (Dbp45A), mRNA 
0   NM_141760.2  CG6554-RA (Art1), mRNA 
0   NM_133110.2  CG7332-RA (CG7332), mRNA 
0   NM_137426.2  CG5033-RA, transcript variant A (CG5033), mRNA 
0   NM_166248.1  CG5033-RB, transcript variant B (CG5033), mRNA 
0   NM_141639.1  CG16779-RA (CG16779), mRNA 
0   NM_169733.2  CG10325-RB, transcript variant B (abd-A), mRNA 
0   NM_057345.2  CG10325-RA, transcript variant A (abd-A), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.