National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1639R-2 
 Symbol l(1)10Bb  Full Name lethal (1) 10Bb 
 CG No CG1639  Old CG No CG1639 
 Synonyms l(1)G0169, 10Ba, l(1)GLM14, l(1)G14, CG1639, l(1)10Bb 
 Accession No (Link to NCBI) NM_078562.2 
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGCCCAAGGTTCGCCGCAGT 
 Primer Seq. 3'
aatctagaggtaccGCGACAACCGCAGTGGACACA 
 Predicted Fragment Size
420 
 IR fragment full Seq
0001 ATGCCCAAGG TTCGCCGCAG TCGCAAACCA CCGCCAGACG GTTGGGAGCT GATCGAACCA 
0061 ACTCTCGAGG AACTGGAGCA AAAAATGCGC GAAGNCGAAA CGGAACCGCA CGAGGGCAAA 
0121 CGCATTACGG AATCCCTTTG GCCCATTTTC AAGATCCACC ACCAGAAGAC ACGATACATC 
0181 TACGATCTAT TCTATCGCCG GAAAGCCATC AGCCGGGAAT TGTACGACTA CTGTCTGAAG 
0241 GAGAAGATTG CCGATGGCAA TCTGATTGCC AAGTGGAAGA AGTCTGGATA CGAGAACCTA 
0301 TGCTGCCTGC GCTGCATTCA AACGAGGGAC ACCAATTTCG GCACGAACTG CATATGCCGG 
0361 GTGCCCAAAT GCAAACTGGA AGAGGGTCGG ATCGTTGAGT GTGTCCACTG CGGTTGTCGC  
 in silico PCR Fragment
0001 ATGCCCAAGG TTCGCCGCAG TCGCAAACCA CCGCCAGACG GTTGGGAGCT GATCGAACCA 
0061 ACTCTCGAGG AACTGGAGCA AAAAATGCGC GAAGCCGAAA CGGAACCGCA CGAGGGCAAA 
0121 CGCATTACGG AATCCCTTTG GCCCATTTTC AAGATCCACC ACCAGAAGAC ACGATACATC 
0181 TACGATCTAT TCTATCGCCG GAAAGCCATC AGCCGGGAAT TGTACGACTA CTGTCTGAAG 
0241 GAGAAGATTG CCGATGGCAA TCTGATTGCC AAGTGGAAGA AGTCTGGATA CGAGAACCTA 
0301 TGCTGCCTGC GCTGCATTCA AACGAGGGAC ACCAATTTCG GCACGAACTG CATATGCCGG 
0361 GTGCCCAAAT GCAAACTGGA AGAGGGTCGG ATCGTTGAGT GTGTCCACTG CGGTTGTCGC  
 Assemble Data

1639R-2.IR_full       1   ATGCCCAAGGTTCGCCGCAGTCGCAAACCACCGCCAGACGGTTGGGAGCTGATCGAACCA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1639R-2.in silico     1   ATGCCCAAGGTTCGCCGCAGTCGCAAACCACCGCCAGACGGTTGGGAGCTGATCGAACCA 60


1639R-2.IR_full       61  ACTCTCGAGGAACTGGAGCAAAAAATGCGCGAAGNCGAAACGGAACCGCACGAGGGCAAA 120
                          |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
1639R-2.in silico     61  ACTCTCGAGGAACTGGAGCAAAAAATGCGCGAAGCCGAAACGGAACCGCACGAGGGCAAA 120


1639R-2.IR_full       121 CGCATTACGGAATCCCTTTGGCCCATTTTCAAGATCCACCACCAGAAGACACGATACATC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1639R-2.in silico     121 CGCATTACGGAATCCCTTTGGCCCATTTTCAAGATCCACCACCAGAAGACACGATACATC 180


1639R-2.IR_full       181 TACGATCTATTCTATCGCCGGAAAGCCATCAGCCGGGAATTGTACGACTACTGTCTGAAG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1639R-2.in silico     181 TACGATCTATTCTATCGCCGGAAAGCCATCAGCCGGGAATTGTACGACTACTGTCTGAAG 240


1639R-2.IR_full       241 GAGAAGATTGCCGATGGCAATCTGATTGCCAAGTGGAAGAAGTCTGGATACGAGAACCTA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1639R-2.in silico     241 GAGAAGATTGCCGATGGCAATCTGATTGCCAAGTGGAAGAAGTCTGGATACGAGAACCTA 300


1639R-2.IR_full       301 TGCTGCCTGCGCTGCATTCAAACGAGGGACACCAATTTCGGCACGAACTGCATATGCCGG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1639R-2.in silico     301 TGCTGCCTGCGCTGCATTCAAACGAGGGACACCAATTTCGGCACGAACTGCATATGCCGG 360


1639R-2.IR_full       361 GTGCCCAAATGCAAACTGGAAGAGGGTCGGATCGTTGAGTGTGTCCACTGCGGTTGTCGC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1639R-2.in silico     361 GTGCCCAAATGCAAACTGGAAGAGGGTCGGATCGTTGAGTGTGTCCACTGCGGTTGTCGC 420

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   402  NM_078562.2  CG1639-RA (l(1)10Bb), mRNA 
0   NM_167109.1  CG4607-RB, transcript variant B (CG4607), mRNA 
0   NM_132152.1  CG4607-RA, transcript variant A (CG4607), mRNA 
0   NM_166019.1  CG18076-RH, transcript variant H (shot), mRNA 
0   NM_166015.1  CG18076-RG, transcript variant G (shot), mRNA 
0   NM_166018.1  CG18076-RC, transcript variant C (shot), mRNA 
0   NM_079009.2  CG18076-RA, transcript variant A (shot), mRNA 
0   NM_166017.1  CG18076-RE, transcript variant E (shot), mRNA 
0   NM_166016.1  CG18076-RB, transcript variant B (shot), mRNA 
0   NM_001031887.1  CG33691-RC, transcript variant C (CG33691), mRNA 
0   NM_001031889.1  CG33691-RA, transcript variant A (CG33691), mRNA 
0   NM_001031888.1  CG33691-RB, transcript variant B (CG33691), mRNA 
0   NM_001031884.1  CG33692-RC, transcript variant C (CG33692), mRNA 
0   NM_001031886.1  CG33692-RA, transcript variant A (CG33692), mRNA 
0   NM_001031885.1  CG33692-RB, transcript variant B (CG33692), mRNA 
0   NM_176182.1  CG8293-RB, transcript variant B (Iap2), mRNA 
0   NM_057779.3  CG8293-RA, transcript variant A (Iap2), mRNA 
0   NM_164820.1  CG13388-RC, transcript variant C (Akap200), mRNA 
0   NM_175984.1  CG13388-RD, transcript variant D (Akap200), mRNA 
0   NM_058111.3  CG13388-RB, transcript variant B (Akap200), mRNA 
0   NM_058112.3  CG13388-RA, transcript variant A (Akap200), mRNA 
0   NM_001032271.1  CG13430-RA, transcript variant A (CG13430), mRNA 
0   NM_001032270.1  CG13430-RB, transcript variant B (CG13430), mRNA 
0   NM_166398.1  CG18065-RA, transcript variant A (CG18065), mRNA 
0   NM_164739.1  CG13778-RB, transcript variant B (Mnn1), mRNA 
0   NM_001042877.1  CG13778-RC, transcript variant C (Mnn1), mRNA 
0   NM_078774.3  CG13778-RA, transcript variant A (Mnn1), mRNA 
0   NM_136552.1  CG8642-RA (CG8642), mRNA 
0   NM_167294.1  CG2371-RC, transcript variant C (CG2371), mRNA 
0   NM_132510.2  CG2371-RB, transcript variant B (CG2371), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.