National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1639R-1 
 Symbol l(1)10Bb  Full Name lethal (1) 10Bb 
 CG No CG1639  Old CG No CG1639 
 Synonyms l(1)G0169, 10Ba, l(1)GLM14, l(1)G14, CG1639, l(1)10Bb 
 Accession No (Link to NCBI) NM_078562.2 
 Inserted Chr. lll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   ATGCCCAAGGTTCGCCGCAGTCGCAAACCACCGCCAGACGGTTGGGAGCTGATCGAACCA 60

                          |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| silico     61  ACTCTCGAGGAACTGGAGCAAAAAATGCGCGAAGCCGAAACGGAACCGCACGAGGGCAAA 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CGCATTACGGAATCCCTTTGGCCCATTTTCAAGATCCACCACCAGAAGACACGATACATC 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 TACGATCTATTCTATCGCCGGAAAGCCATCAGCCGGGAATTGTACGACTACTGTCTGAAG 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 GAGAAGATTGCCGATGGCAATCTGATTGCCAAGTGGAAGAAGTCTGGATACGAGAACCTA 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 TGCTGCCTGCGCTGCATTCAAACGAGGGACACCAATTTCGGCACGAACTGCATATGCCGG 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GTGCCCAAATGCAAACTGGAAGAGGGTCGGATCGTTGAGTGTGTCCACTGCGGTTGTCGC 420

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   402  NM_078562.2  CG1639-RA (l(1)10Bb), mRNA 
0   NM_167109.1  CG4607-RB, transcript variant B (CG4607), mRNA 
0   NM_132152.1  CG4607-RA, transcript variant A (CG4607), mRNA 
0   NM_166019.1  CG18076-RH, transcript variant H (shot), mRNA 
0   NM_166015.1  CG18076-RG, transcript variant G (shot), mRNA 
0   NM_166018.1  CG18076-RC, transcript variant C (shot), mRNA 
0   NM_079009.2  CG18076-RA, transcript variant A (shot), mRNA 
0   NM_166017.1  CG18076-RE, transcript variant E (shot), mRNA 
0   NM_166016.1  CG18076-RB, transcript variant B (shot), mRNA 
0   NM_001031887.1  CG33691-RC, transcript variant C (CG33691), mRNA 
0   NM_001031889.1  CG33691-RA, transcript variant A (CG33691), mRNA 
0   NM_001031888.1  CG33691-RB, transcript variant B (CG33691), mRNA 
0   NM_001031884.1  CG33692-RC, transcript variant C (CG33692), mRNA 
0   NM_001031886.1  CG33692-RA, transcript variant A (CG33692), mRNA 
0   NM_001031885.1  CG33692-RB, transcript variant B (CG33692), mRNA 
0   NM_176182.1  CG8293-RB, transcript variant B (Iap2), mRNA 
0   NM_057779.3  CG8293-RA, transcript variant A (Iap2), mRNA 
0   NM_164820.1  CG13388-RC, transcript variant C (Akap200), mRNA 
0   NM_175984.1  CG13388-RD, transcript variant D (Akap200), mRNA 
0   NM_058111.3  CG13388-RB, transcript variant B (Akap200), mRNA 
0   NM_058112.3  CG13388-RA, transcript variant A (Akap200), mRNA 
0   NM_001032271.1  CG13430-RA, transcript variant A (CG13430), mRNA 
0   NM_001032270.1  CG13430-RB, transcript variant B (CG13430), mRNA 
0   NM_166398.1  CG18065-RA, transcript variant A (CG18065), mRNA 
0   NM_164739.1  CG13778-RB, transcript variant B (Mnn1), mRNA 
0   NM_001042877.1  CG13778-RC, transcript variant C (Mnn1), mRNA 
0   NM_078774.3  CG13778-RA, transcript variant A (Mnn1), mRNA 
0   NM_136552.1  CG8642-RA (CG8642), mRNA 
0   NM_167294.1  CG2371-RC, transcript variant C (CG2371), mRNA 
0   NM_132510.2  CG2371-RB, transcript variant B (CG2371), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.