National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1636R-3 
 Symbol CG1636  Full Name CG1636 
 CG No CG1636  Old CG No CG1636 
 Synonyms CG1636 
 Accession No (Link to NCBI) NM_132242.4 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Honjo K, Mauthner SE, Wang Y, Skene JHP, Tracey WD Jr.
Nociceptor-Enriched Genes Required for Normal Thermal Nociception.
Cell Rep (2016) 16(2) 295-303 [ PubMed ID = 27346357 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCGGGGTCTTTTGGATATTCGT 
 Primer Seq. 3'
aatctagaggtaccAGGGCAGTAGGTTGACAAACA 
 Predicted Fragment Size
584 
 IR fragment full Seq
0001 CGGGGTCTTT TGGATATTCG TGGCGTTGTC TTGCGGCTAC TACGCCTTCC AGCGGCTCTT 
0061 CCAGTTCTTT CTGAAGTCGT CGAGCATGAA GCACTTTCAG CGGAgGCTGT TCGCCCGCGT 
0121 CATTTGGAAC ATCGCCTTCT ATGCGGCCAG CTGCCTGTTC CTGCACTTCT ACAACGAGTT 
0181 CATGATCCTG CCGCAGCTGA TGAAGAACCA AGGGACGCTA CTCGCTCTTC ATACTCCTCG 
0241 GAGAACCTGA TCTTCTATCG ATCTCATCAG GCGGAAAAGT TTCAGTTCTA CTCGATCTTC 
0301 ATTATCACGT TCTACCTGCA TGGGGCGTGG TTGGACTTCA AGGACGCTGA CTTCCTGGAG 
0361 GTGGGCTCCA AGGGACTCTA CCTGCTGTCC CTCGTCGCCA TCGATGTTTA CAGGTACGAA 
0421 AACTACTTTG TGGGCCTGAA TCTGACGGTG GGTCTGTACA GCATACTCAC CGAGGTGCTA 
0481 GCCCTGTTGG TCCTGCCCAG CACCAATTCA CACCGGATCA TCTACCAGGT TTTCCTCGGT 
0541 CTGCGCATCA TGGTGTGGGC GTATGTGTTT GTCAACCTAC TGCCCT 
 in silico PCR Fragment
0001 CGGGGTCTTT TGGATATTCG TGGCGTTGTC TTGCGGCTAC TACGCCTTCC AGCGGCTCTT 
0061 CCAGTTCTTT CTGAAGTCGT CGAGCATGAA GCACTTTCAG CGGAGGCTGT TCGCCCGCGT 
0121 CATTTGGAAC ATCGCCTTCT ATGCGGCCAG CTGCCTGTTC CTGCACTTCT ACAACGAGTT 
0181 CATGATCCTG CCGCAGCTGA TGAAGAACCA A-GGACGCTA CTCGCTCTTC -TACTCCTCG 
0241 GAGAACCTGA TCTTCTATCG ATCTCATCAG GCGGAAAAGT TTCAGTTCTA CTCGATCTTC 
0301 ATTATCACGT TCTACCTGCA TGGGGCGTGG TTGGACTTCA AGGACGCTGA CTTCCTGGAG 
0361 GTGGGCTCCA AGGGACTCTA CCTGCTGTCC CTCGTCGCCA TCGATGTTTA CAGGTACGAA 
0421 AACTACTTTG TGGGCCTGAA TCTAACGGTG GGTCTGTACA GCATACTCAC CGAGGTGCTA 
0481 GCCCTGTTGG TCCTGCCCAG CACCAATTCA CACCGGATCA TCTACCAGGT TTTCCTCGGT 
0541 CTGCGCATCA TGGTGTGGGC GTATGTGTTT GTCAACCTAC TGCCCT 
 Assemble Data

1636R-3.IR_full       1   CGGGGTCTTTTGGATATTCGTGGCGTTGTCTTGCGGCTACTACGCCTTCCAGCGGCTCTT 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1636R-3.in silico     1   CGGGGTCTTTTGGATATTCGTGGCGTTGTCTTGCGGCTACTACGCCTTCCAGCGGCTCTT 60


1636R-3.IR_full       61  CCAGTTCTTTCTGAAGTCGTCGAGCATGAAGCACTTTCAGCGGAGGCTGTTCGCCCGCGT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1636R-3.in silico     61  CCAGTTCTTTCTGAAGTCGTCGAGCATGAAGCACTTTCAGCGGAGGCTGTTCGCCCGCGT 120


1636R-3.IR_full       121 CATTTGGAACATCGCCTTCTATGCGGCCAGCTGCCTGTTCCTGCACTTCTACAACGAGTT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1636R-3.in silico     121 CATTTGGAACATCGCCTTCTATGCGGCCAGCTGCCTGTTCCTGCACTTCTACAACGAGTT 180


1636R-3.IR_full       181 CATGATCCTGCCGCAGCTGATGAAGAACCAAGGGACGCTACTCGCTCTTCATACTCCTCG 240
                          ||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||
1636R-3.in silico     181 CATGATCCTGCCGCAGCTGATGAAGAACCAA-GGACGCTACTCGCTCTTC-TACTCCTCG 240


1636R-3.IR_full       241 GAGAACCTGATCTTCTATCGATCTCATCAGGCGGAAAAGTTTCAGTTCTACTCGATCTTC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1636R-3.in silico     241 GAGAACCTGATCTTCTATCGATCTCATCAGGCGGAAAAGTTTCAGTTCTACTCGATCTTC 300


1636R-3.IR_full       301 ATTATCACGTTCTACCTGCATGGGGCGTGGTTGGACTTCAAGGACGCTGACTTCCTGGAG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1636R-3.in silico     301 ATTATCACGTTCTACCTGCATGGGGCGTGGTTGGACTTCAAGGACGCTGACTTCCTGGAG 360


1636R-3.IR_full       361 GTGGGCTCCAAGGGACTCTACCTGCTGTCCCTCGTCGCCATCGATGTTTACAGGTACGAA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1636R-3.in silico     361 GTGGGCTCCAAGGGACTCTACCTGCTGTCCCTCGTCGCCATCGATGTTTACAGGTACGAA 420


1636R-3.IR_full       421 AACTACTTTGTGGGCCTGAATCTGACGGTGGGTCTGTACAGCATACTCACCGAGGTGCTA 480
                          ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
1636R-3.in silico     421 AACTACTTTGTGGGCCTGAATCTAACGGTGGGTCTGTACAGCATACTCACCGAGGTGCTA 480


1636R-3.IR_full       481 GCCCTGTTGGTCCTGCCCAGCACCAATTCACACCGGATCATCTACCAGGTTTTCCTCGGT 540
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1636R-3.in silico     481 GCCCTGTTGGTCCTGCCCAGCACCAATTCACACCGGATCATCTACCAGGTTTTCCTCGGT 540


1636R-3.IR_full       541 CTGCGCATCATGGTGTGGGCGTATGTGTTTGTCAACCTACTGCCCT 586
                          ||||||||||||||||||||||||||||||||||||||||||||||
1636R-3.in silico     541 CTGCGCATCATGGTGTGGGCGTATGTGTTTGTCAACCTACTGCCCT 586

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   566  NM_132242.4  CG1636-RA (CG1636), mRNA 
0   NM_176104.1  CG33087-RC (CG33087), mRNA 
0   NM_170082.1  CG10251-RA (CG10251), mRNA 
0   NM_205987.1  CG32972-RA, transcript variant A (CG32972), mRNA 
0   NM_176037.1  CG32972-RB, transcript variant B (CG32972), mRNA 
0   NM_139949.2  CG7185-RA (CG7185), mRNA 
0   NM_079388.2  CG16725-RA (Smn), mRNA 
0   NM_142445.1  CG7146-RA (CG7146), mRNA 
0   NM_169003.2  CG31522-RA, transcript variant A (CG31522), mRNA 
0   NM_169002.2  CG31522-RD, transcript variant D (CG31522), mRNA 
0   NM_169001.2  CG31522-RB, transcript variant B (CG31522), mRNA 
0   NM_139498.1  CG9965-RA (CG9965), mRNA 
0   NM_142306.3  CG10345-RA (CG10345), mRNA 
0   10  NM_144448.2  CG1915-RC, transcript variant C (sls), mRNA 
0   NM_134282.1  CG8651-RA, transcript variant A (trx), mRNA 
0   NM_057422.2  CG8651-RB, transcript variant B (trx), mRNA 
0   NM_001014621.1  CG8651-RE, transcript variant E (trx), mRNA 
0   NM_057421.2  CG8651-RD, transcript variant D (trx), mRNA 
0   NM_134281.1  CG8651-RC, transcript variant C (trx), mRNA 
0   NM_136941.2  CG8828-RA (CG8828), mRNA 
0   NM_164431.1  CG17654-RB, transcript variant B (Eno), mRNA 
0   NM_057466.2  CG8896-RA (18w), mRNA 
0   NM_164434.1  CG17654-RE, transcript variant E (Eno), mRNA 
0   NM_164432.1  CG17654-RC, transcript variant C (Eno), mRNA 
0   NM_058073.3  CG17654-RA, transcript variant A (Eno), mRNA 
0   NM_164433.1  CG17654-RD, transcript variant D (Eno), mRNA 
0   NM_130556.2  CG14785-RA (CG14785), mRNA 
0   NM_170649.1  CG4196-RB, transcript variant B (CG4196), mRNA 
0   NM_142169.2  CG4196-RC, transcript variant C (CG4196), mRNA 
0   NM_139368.1  CG12003-RA (CG12003), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.