National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1636R-2 
 Symbol CG1636  Full Name CG1636 
 CG No CG1636  Old CG No CG1636 
 Synonyms CG1636 
 Accession No (Link to NCBI) NM_132242.4 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Honjo K, Mauthner SE, Wang Y, Skene JHP, Tracey WD Jr.
Nociceptor-Enriched Genes Required for Normal Thermal Nociception.
Cell Rep (2016) 16(2) 295-303 [ PubMed ID = 27346357 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   CGGGGTCTTTTGGATATTCGTGGCGTTGTCTTGCGGCTACTACGCCTTCCAGCGGCTCTT 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  CCAGTTCTTTCTGAAGTCGTCGAGCATGAAGCACTTTCAGCGGAGGCTGTTCGCCCGCGT 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CATTTGGAACATCGCCTTCTATGCGGCCAGCTGCCTGTTCCTGCACTTCTACAACGAGTT 180

                          ||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||| silico     181 CATGATCCTGCCGCAGCTGATGAAGAACCAA-GGACGCTACTCGCTCTTC-TACTCCTCG 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 GAGAACCTGATCTTCTATCGATCTCATCAGGCGGAAAAGTTTCAGTTCTACTCGATCTTC 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 ATTATCACGTTCTACCTGCATGGGGCGTGGTTGGACTTCAAGGACGCTGACTTCCTGGAG 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GTGGGCTCCAAGGGACTCTACCTGCTGTCCCTCGTCGCCATCGATGTTTACAGGTACGAA 420

                          ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| silico     421 AACTACTTTGTGGGCCTGAATCTAACGGTGGGTCTGTACAGCATACTCACCGAGGTGCTA 480

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     481 GCCCTGTTGGTCCTGCCCAGCACCAATTCACACCGGATCATCTACCAGGTTTTCCTCGGT 540

                          |||||||||||||||||||||||||||||||||||||||||||||| silico     541 CTGCGCATCATGGTGTGGGCGTATGTGTTTGTCAACCTACTGCCCT 586

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   566  NM_132242.4  CG1636-RA (CG1636), mRNA 
0   NM_176104.1  CG33087-RC (CG33087), mRNA 
0   NM_170082.1  CG10251-RA (CG10251), mRNA 
0   NM_205987.1  CG32972-RA, transcript variant A (CG32972), mRNA 
0   NM_176037.1  CG32972-RB, transcript variant B (CG32972), mRNA 
0   NM_139949.2  CG7185-RA (CG7185), mRNA 
0   NM_079388.2  CG16725-RA (Smn), mRNA 
0   NM_142445.1  CG7146-RA (CG7146), mRNA 
0   NM_169003.2  CG31522-RA, transcript variant A (CG31522), mRNA 
0   NM_169002.2  CG31522-RD, transcript variant D (CG31522), mRNA 
0   NM_169001.2  CG31522-RB, transcript variant B (CG31522), mRNA 
0   NM_139498.1  CG9965-RA (CG9965), mRNA 
0   NM_142306.3  CG10345-RA (CG10345), mRNA 
0   10  NM_144448.2  CG1915-RC, transcript variant C (sls), mRNA 
0   NM_134282.1  CG8651-RA, transcript variant A (trx), mRNA 
0   NM_057422.2  CG8651-RB, transcript variant B (trx), mRNA 
0   NM_001014621.1  CG8651-RE, transcript variant E (trx), mRNA 
0   NM_057421.2  CG8651-RD, transcript variant D (trx), mRNA 
0   NM_134281.1  CG8651-RC, transcript variant C (trx), mRNA 
0   NM_136941.2  CG8828-RA (CG8828), mRNA 
0   NM_164431.1  CG17654-RB, transcript variant B (Eno), mRNA 
0   NM_057466.2  CG8896-RA (18w), mRNA 
0   NM_164434.1  CG17654-RE, transcript variant E (Eno), mRNA 
0   NM_164432.1  CG17654-RC, transcript variant C (Eno), mRNA 
0   NM_058073.3  CG17654-RA, transcript variant A (Eno), mRNA 
0   NM_164433.1  CG17654-RD, transcript variant D (Eno), mRNA 
0   NM_130556.2  CG14785-RA (CG14785), mRNA 
0   NM_170649.1  CG4196-RB, transcript variant B (CG4196), mRNA 
0   NM_142169.2  CG4196-RC, transcript variant C (CG4196), mRNA 
0   NM_139368.1  CG12003-RA (CG12003), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.