National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 15907R-2 
 Symbol ham  Full Name hamlet 
 CG No CG31753  Old CG No CG15907 
 Synonyms CG15906, CG10568, CG31753, CG15907, ham 
 Accession No (Link to NCBI) NM_165262.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Nitta Y, Yamazaki D, Sugie A, Hiroi M, Tabata T.
DISCO Interacting Protein 2 regulates axonal bifurcation and guidance of Drosophila mushroom body neurons.
Dev. Biol. (2017) 421(2) 233-244 [ PubMed ID = 27908785 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCGACGACTTCGATCCAAGTG 
 Primer Seq. 3'
aatctagaggtaccATCGTTGGGTTGGTGGCTGAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 gCGANCGACT TCGATCCAAG TGCAAGTGTA GCGCGCCACC ATCATCACCT CCATCACCTG 
0061 GATCTGAGTG CCAGGAGTCA GGGCTTCAAT CCACTGTCTG AACAAATCGA GGATTCATTC 
0121 GCCGCCCGCC ATCACTTACC GCAGCAGGAG CCCGTGGAAG GATCTCCGCC GAGGCGGGAT 
0181 CATCTTGATA TACAGGATCA GGAGCTACTT CACCATCCCA ATCATTTCCA CCAGCAGAAC 
0241 CAGCGACAAC AGCCACCGCC TCCCACGTTG CCGCTGTCCG TGGAATCCTC CTCCGCCGCA 
0301 GCCGCCTCCG TCGGACGGCA TGGATGCCTT CTTCAAGGAN CCGCGCCCAG GCGGAGCACA 
0361 TCCTGCAGGA GTGGGTGCGT AGGCGCGAAC CAGTCTGTGA GCTGGACATC CGTGATAGTG 
0421 GTGGCGTCTA CGCCAAGACG CCGCTCCAGA GGGGCACTCG CTACGGACCC NTTTCCCATG 
0481 AAGCTCAGCC ACCAACCCAA CGAT 
 in silico PCR Fragment
0001 GCGA-CGACT TCGATCCAAG TGCAAGTGTA GCGCGCCACC ATCATCACCT CCATCACCTG 
0061 GATCTGAGTG CCAGGAGTCA GGGCTTCAAT CCACTGTCTG AACAAATCGA GGATTCATTC 
0121 GCCGCCCGCC ATCACTTACC GCAGCAGGAG CCCGTGGAAG GATCTCCGCC GAGGCGGGAT 
0181 CATCTTGATA TACAGGATCA GGAGCTACTT CACCATCCCA ATCATTTCCA CCAGCAGAAC 
0241 CAGCGACAAC AGCCACCGCC TCCCACGTTG CCGCTGTCCG TGGAATCCTC CTCCGCCGCA 
0301 GCCGCCTCCG TC-GACGGCA TGGATGCCTT CTTCAAGGA- CCGCGCCCAG GCGGAGCACA 
0361 TCCTGCAGGA GTGGGTGCGT AGGCGCGAAC CAGTCTGTGA GCTGGACATC CGTGATAGTG 
0421 GTGGCGTCTA CGCCAAGACG CCGCTCCAGA GGGGCACTCG CTACGGACCC -TTTCCCATG 
0481 AAGCTCAGCC ACCAACCCAA CGAT 
 Assemble Data

15907R-2.IR_full       1   GCGANCGACTTCGATCCAAGTGCAAGTGTAGCGCGCCACCATCATCACCTCCATCACCTG 60
                           |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
15907R-2.in silico     1   GCGA-CGACTTCGATCCAAGTGCAAGTGTAGCGCGCCACCATCATCACCTCCATCACCTG 60


15907R-2.IR_full       61  GATCTGAGTGCCAGGAGTCAGGGCTTCAATCCACTGTCTGAACAAATCGAGGATTCATTC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15907R-2.in silico     61  GATCTGAGTGCCAGGAGTCAGGGCTTCAATCCACTGTCTGAACAAATCGAGGATTCATTC 120


15907R-2.IR_full       121 GCCGCCCGCCATCACTTACCGCAGCAGGAGCCCGTGGAAGGATCTCCGCCGAGGCGGGAT 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15907R-2.in silico     121 GCCGCCCGCCATCACTTACCGCAGCAGGAGCCCGTGGAAGGATCTCCGCCGAGGCGGGAT 180


15907R-2.IR_full       181 CATCTTGATATACAGGATCAGGAGCTACTTCACCATCCCAATCATTTCCACCAGCAGAAC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15907R-2.in silico     181 CATCTTGATATACAGGATCAGGAGCTACTTCACCATCCCAATCATTTCCACCAGCAGAAC 240


15907R-2.IR_full       241 CAGCGACAACAGCCACCGCCTCCCACGTTGCCGCTGTCCGTGGAATCCTCCTCCGCCGCA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15907R-2.in silico     241 CAGCGACAACAGCCACCGCCTCCCACGTTGCCGCTGTCCGTGGAATCCTCCTCCGCCGCA 300


15907R-2.IR_full       301 GCCGCCTCCGTCGGACGGCATGGATGCCTTCTTCAAGGANCCGCGCCCAGGCGGAGCACA 360
                           |||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||
15907R-2.in silico     301 GCCGCCTCCGTC-GACGGCATGGATGCCTTCTTCAAGGA-CCGCGCCCAGGCGGAGCACA 360


15907R-2.IR_full       361 TCCTGCAGGAGTGGGTGCGTAGGCGCGAACCAGTCTGTGAGCTGGACATCCGTGATAGTG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15907R-2.in silico     361 TCCTGCAGGAGTGGGTGCGTAGGCGCGAACCAGTCTGTGAGCTGGACATCCGTGATAGTG 420


15907R-2.IR_full       421 GTGGCGTCTACGCCAAGACGCCGCTCCAGAGGGGCACTCGCTACGGACCCNTTTCCCATG 480
                           |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
15907R-2.in silico     421 GTGGCGTCTACGCCAAGACGCCGCTCCAGAGGGGCACTCGCTACGGACCC-TTTCCCATG 480


15907R-2.IR_full       481 AAGCTCAGCCACCAACCCAACGAT 504
                           ||||||||||||||||||||||||
15907R-2.in silico     481 AAGCTCAGCCACCAACCCAACGAT 504

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_165262.2  CG31753-RA (ham), mRNA 
0   11  26  NM_079093.2  CG9888-RA (Fib), mRNA 
0   10  NM_080223.2  CG3986-RA (Cht4), mRNA 
0   NM_167128.1  CG32719-RA (CG32719), mRNA 
0   NM_205901.1  CG3304-RC, transcript variant C (CG3304), mRNA 
0   10  27  NM_143742.2  CG5812-RA (GCR(ich)), mRNA 
0   10  NM_135841.4  CG8954-RA, transcript variant A (Smg5), mRNA 
0   10  NM_165069.1  CG8954-RB, transcript variant B (Smg5), mRNA 
0   21  NM_079561.2  CG9755-RC, transcript variant C (pum), mRNA 
0   19  NM_169259.1  CG9755-RD, transcript variant D (pum), mRNA 
0   19  NM_169258.1  CG9755-RA, transcript variant A (pum), mRNA 
0   16  NM_133012.2  CG32560-RA (CG32560), mRNA 
0   13  NM_206382.1  CG5151-RB, transcript variant B (CG5151), mRNA 
0   12  NM_140587.1  CG5151-RA, transcript variant A (CG5151), mRNA 
0   10  NM_164557.1  CG10021-RB, transcript variant B (bowl), mRNA 
0   10  NM_057535.2  CG10021-RC, transcript variant C (bowl), mRNA 
0   10  NM_164558.1  CG10021-RD, transcript variant D (bowl), mRNA 
0   10  NM_164556.1  CG10021-RA, transcript variant A (bowl), mRNA 
0   NM_164328.2  CG32490-RG, transcript variant G (cpx), mRNA 
0   NM_078527.2  CG2151-RA, transcript variant A (Trxr-1), mRNA 
0   NM_164329.2  CG32490-RI, transcript variant I (cpx), mRNA 
0   NM_164331.2  CG32490-RH, transcript variant H (cpx), mRNA 
0   NM_164330.2  CG32490-RC, transcript variant C (cpx), mRNA 
0   NM_164327.2  CG32490-RA, transcript variant A (cpx), mRNA 
0   NM_080280.2  CG32490-RE, transcript variant E (cpx), mRNA 
0   NM_001014602.1  CG32490-RK, transcript variant K (cpx), mRNA 
0   NM_001014603.1  CG32490-RJ, transcript variant J (cpx), mRNA 
0   NM_167149.1  CG2151-RB, transcript variant B (Trxr-1), mRNA 
0   NM_167150.1  CG2151-RC, transcript variant C (Trxr-1), mRNA 
0   NM_166546.2  CG30092-RD, transcript variant D (jbug), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.