National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 15907R-1 
 Symbol ham  Full Name hamlet 
 CG No CG31753  Old CG No CG15907 
 Synonyms CG15906, CG10568, CG31753, CG15907, ham 
 Accession No (Link to NCBI) NM_165262.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Nitta Y, Yamazaki D, Sugie A, Hiroi M, Tabata T.
DISCO Interacting Protein 2 regulates axonal bifurcation and guidance of Drosophila mushroom body neurons.
Dev. Biol. (2017) 421(2) 233-244 [ PubMed ID = 27908785 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   GCGA-CGACTTCGATCCAAGTGCAAGTGTAGCGCGCCACCATCATCACCTCCATCACCTG 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GATCTGAGTGCCAGGAGTCAGGGCTTCAATCCACTGTCTGAACAAATCGAGGATTCATTC 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GCCGCCCGCCATCACTTACCGCAGCAGGAGCCCGTGGAAGGATCTCCGCCGAGGCGGGAT 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 CATCTTGATATACAGGATCAGGAGCTACTTCACCATCCCAATCATTTCCACCAGCAGAAC 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CAGCGACAACAGCCACCGCCTCCCACGTTGCCGCTGTCCGTGGAATCCTCCTCCGCCGCA 300

                           |||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||| silico     301 GCCGCCTCCGTC-GACGGCATGGATGCCTTCTTCAAGGA-CCGCGCCCAGGCGGAGCACA 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 TCCTGCAGGAGTGGGTGCGTAGGCGCGAACCAGTCTGTGAGCTGGACATCCGTGATAGTG 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| silico     421 GTGGCGTCTACGCCAAGACGCCGCTCCAGAGGGGCACTCGCTACGGACCC-TTTCCCATG 480

15907R-1.IR_full       481 AAGCTCAGCCACCAACCCAACGAT 504
                           |||||||||||||||||||||||| silico     481 AAGCTCAGCCACCAACCCAACGAT 504

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_165262.2  CG31753-RA (ham), mRNA 
0   11  26  NM_079093.2  CG9888-RA (Fib), mRNA 
0   10  NM_080223.2  CG3986-RA (Cht4), mRNA 
0   NM_167128.1  CG32719-RA (CG32719), mRNA 
0   NM_205901.1  CG3304-RC, transcript variant C (CG3304), mRNA 
0   10  27  NM_143742.2  CG5812-RA (GCR(ich)), mRNA 
0   10  NM_135841.4  CG8954-RA, transcript variant A (Smg5), mRNA 
0   10  NM_165069.1  CG8954-RB, transcript variant B (Smg5), mRNA 
0   21  NM_079561.2  CG9755-RC, transcript variant C (pum), mRNA 
0   19  NM_169259.1  CG9755-RD, transcript variant D (pum), mRNA 
0   19  NM_169258.1  CG9755-RA, transcript variant A (pum), mRNA 
0   16  NM_133012.2  CG32560-RA (CG32560), mRNA 
0   13  NM_206382.1  CG5151-RB, transcript variant B (CG5151), mRNA 
0   12  NM_140587.1  CG5151-RA, transcript variant A (CG5151), mRNA 
0   10  NM_164557.1  CG10021-RB, transcript variant B (bowl), mRNA 
0   10  NM_057535.2  CG10021-RC, transcript variant C (bowl), mRNA 
0   10  NM_164558.1  CG10021-RD, transcript variant D (bowl), mRNA 
0   10  NM_164556.1  CG10021-RA, transcript variant A (bowl), mRNA 
0   NM_164328.2  CG32490-RG, transcript variant G (cpx), mRNA 
0   NM_078527.2  CG2151-RA, transcript variant A (Trxr-1), mRNA 
0   NM_164329.2  CG32490-RI, transcript variant I (cpx), mRNA 
0   NM_164331.2  CG32490-RH, transcript variant H (cpx), mRNA 
0   NM_164330.2  CG32490-RC, transcript variant C (cpx), mRNA 
0   NM_164327.2  CG32490-RA, transcript variant A (cpx), mRNA 
0   NM_080280.2  CG32490-RE, transcript variant E (cpx), mRNA 
0   NM_001014602.1  CG32490-RK, transcript variant K (cpx), mRNA 
0   NM_001014603.1  CG32490-RJ, transcript variant J (cpx), mRNA 
0   NM_167149.1  CG2151-RB, transcript variant B (Trxr-1), mRNA 
0   NM_167150.1  CG2151-RC, transcript variant C (Trxr-1), mRNA 
0   NM_166546.2  CG30092-RD, transcript variant D (jbug), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.