National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 15882R-1 
 Symbol CG15882  Full Name CG15882 
 CG No CG15882  Old CG No CG15882 
 Synonyms CG15882 
 Accession No (Link to NCBI) NM_133120.1 
 Inserted Chr. lll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTCTTTGAAGGAGCTGCTCAGT 
 Primer Seq. 3'
aatctagaggtaccATATTCGTAGACCAGGTGTGC 
 Predicted Fragment Size
414 
 IR fragment full Seq
0001 TCTTTGAAGG AGCTGCTCAG TGAGGACACA CTCTCTGAAT TGGCTACCCC GAATGATGTC 
0061 GACATTGCCG GCGAGGAAAA GAACCTCGAG GGTCAATCTG TTTCGAAGGA AGATCCACCG 
0121 CCTGCGGCAG TTGTACCCAA AGCGCCCAAA GCGCCCAAAG CGNCCAATAA TCCCGAAGCG 
0181 CTAACCCAAA AGCAGAGTAT GGACTATGCG GCACGGATCG TGAAGGTCAT CAACCTACAG 
0241 ATGCAAAATG TGGTGCATAA AACGTTCATG ATGATGCAAT CACCACTCCC TCTCCGGAAC 
0301 AGGCTACCAG TGGTCGTGTC CACCATGATC CGCTCCCGTA GGGCACCCAA GTTGAAGCTC 
0361 AAAGATGTGA GGAGAGTGAT CACGGGCCTG GCGCTGCATC GTGCACACCT GGTCTACGAA 
0421 TAT 
 in silico PCR Fragment
0001 TCTTTGAAGG AGCTGCTCAG TGAGGACACA CTCTCTGAAT TGGCTACCCC GAATGATGTC 
0061 GACATTGCCG GCGAGGAAAA GAACCTCGAG GGTCAATCTG TTTCGAAGGA AGATCCACCG 
0121 CCTGCGGCAG TTGTACCCAA AGCGACCAAA GCGC------ ---CCAATAA TCCCGAAGCG 
0181 CTAACCCAAA AGCAGAGTAT GGACTATGCG GCACGGATCG TGAAGGTCAT CAACCTACAG 
0241 ATGCAAAATG TGGTGCATAA AACGTTCATG ATGATGCAAT CACCACTCCC TCTCCGGAAC 
0301 AGGCTACCAG TGGTCGTGTC CACCATGATC CGCTCCCGTA GGGCACCCAA GTTGAAGCTC 
0361 AAAGATGTGA GGAGAGTGAT CACGGGCCTG GCGCTGCATC GTGCACACCT GGTCTACGAA 
0421 TAT 
 Assemble Data

15882R-1.IR_full       1   TCTTTGAAGGAGCTGCTCAGTGAGGACACACTCTCTGAATTGGCTACCCCGAATGATGTC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15882R-1.in silico     1   TCTTTGAAGGAGCTGCTCAGTGAGGACACACTCTCTGAATTGGCTACCCCGAATGATGTC 60


15882R-1.IR_full       61  GACATTGCCGGCGAGGAAAAGAACCTCGAGGGTCAATCTGTTTCGAAGGAAGATCCACCG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15882R-1.in silico     61  GACATTGCCGGCGAGGAAAAGAACCTCGAGGGTCAATCTGTTTCGAAGGAAGATCCACCG 120


15882R-1.IR_full       121 CCTGCGGCAGTTGTACCCAAAGCGCCCAAAGCGCCCAAAGCGNCCAATAATCCCGAAGCG 180
                           |||||||||||||||||||||||| |||||||||         |||||||||||||||||
15882R-1.in silico     121 CCTGCGGCAGTTGTACCCAAAGCGACCAAAGCGC---------CCAATAATCCCGAAGCG 180


15882R-1.IR_full       181 CTAACCCAAAAGCAGAGTATGGACTATGCGGCACGGATCGTGAAGGTCATCAACCTACAG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15882R-1.in silico     181 CTAACCCAAAAGCAGAGTATGGACTATGCGGCACGGATCGTGAAGGTCATCAACCTACAG 240


15882R-1.IR_full       241 ATGCAAAATGTGGTGCATAAAACGTTCATGATGATGCAATCACCACTCCCTCTCCGGAAC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15882R-1.in silico     241 ATGCAAAATGTGGTGCATAAAACGTTCATGATGATGCAATCACCACTCCCTCTCCGGAAC 300


15882R-1.IR_full       301 AGGCTACCAGTGGTCGTGTCCACCATGATCCGCTCCCGTAGGGCACCCAAGTTGAAGCTC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15882R-1.in silico     301 AGGCTACCAGTGGTCGTGTCCACCATGATCCGCTCCCGTAGGGCACCCAAGTTGAAGCTC 360


15882R-1.IR_full       361 AAAGATGTGAGGAGAGTGATCACGGGCCTGGCGCTGCATCGTGCACACCTGGTCTACGAA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15882R-1.in silico     361 AAAGATGTGAGGAGAGTGATCACGGGCCTGGCGCTGCATCGTGCACACCTGGTCTACGAA 420


15882R-1.IR_full       421 TAT 423
                           |||
15882R-1.in silico     421 TAT 423

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.