National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 15881R-3 
 Symbol CG15881  Full Name CG15881 
 CG No CG15881  Old CG No CG15881 
 Synonyms BcDNA:HL01254, CG15881 
 Accession No (Link to NCBI) NM_168819.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGCGAGATGTGGACGACAAG 
 Primer Seq. 3'
aatctagaggtaccTGGCCAGCATGAAAATAGGAC 
 Predicted Fragment Size
356 
 IR fragment full Seq
0001 ATGCGAGATG TGGACGACAA GATTATATAT GCACTAAATG CCCTGCCAAC GGAGTCGTTT 
0061 AAGGGTCAAG TGAACAGTGA AAGCACCTGT CGCGATCTGT ACGCGAAGCT CCAGGAGTCA 
0121 CACTTGGCCA GGCAAGAAAG CATACGCAGT TGCATAACAA TTTCGGCTAG TAATCTGAAG 
0181 AAGCTAAGGG AAAAGCGGGA GACCCAGCCG GATGATGTGG ATACGGATAA CCAGTTTAGG 
0241 GCGGAGCAGC GCAAGTTGCG GGTTCTTCCA GGCCGAGCTC AATGTCGAGG ACATCATTAA 
0301 AGAGCGTTCC TACAAGACCT TCAATGAACG ATGCCGGTCC TATTTTCATG CTGGCAGGNA 
0361 CCA 
 in silico PCR Fragment
0001 ATGCGAGATG TGGACGACAA GATTATATAT GCACTAAATG CCCTGCCAAC GGAGTCGTTT 
0061 AAGGGTCAAG TGAACAGTGA AAGCACCTGT CGCGATCTGT ACGCGAAGCT CCAGGAGTCA 
0121 CACTTGGCCA GGCAAGAAAG CATACGCAGT TGCATAACAA TTTCGGCTAG TAATCTGAAG 
0181 AAGCTAAGGG AAAAGCGGGA GACCCAGCCG GATGATGTGG ATACGGATAA CCAGTTTAGG 
0241 GCGGAGCAGC GCAAGCTGCG GGTTC-TCCA GGCCGAGCTC AATGTCGAGG ACATCATTAA 
0301 AGATCGTTCC TACAAGACCT TCAATGAACG ATGCCGGTCC TATTTTCATG CTGG------ 
0361 CCA 
 Assemble Data

15881R-3.IR_full       1   ATGCGAGATGTGGACGACAAGATTATATATGCACTAAATGCCCTGCCAACGGAGTCGTTT 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15881R-3.in silico     1   ATGCGAGATGTGGACGACAAGATTATATATGCACTAAATGCCCTGCCAACGGAGTCGTTT 60


15881R-3.IR_full       61  AAGGGTCAAGTGAACAGTGAAAGCACCTGTCGCGATCTGTACGCGAAGCTCCAGGAGTCA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15881R-3.in silico     61  AAGGGTCAAGTGAACAGTGAAAGCACCTGTCGCGATCTGTACGCGAAGCTCCAGGAGTCA 120


15881R-3.IR_full       121 CACTTGGCCAGGCAAGAAAGCATACGCAGTTGCATAACAATTTCGGCTAGTAATCTGAAG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15881R-3.in silico     121 CACTTGGCCAGGCAAGAAAGCATACGCAGTTGCATAACAATTTCGGCTAGTAATCTGAAG 180


15881R-3.IR_full       181 AAGCTAAGGGAAAAGCGGGAGACCCAGCCGGATGATGTGGATACGGATAACCAGTTTAGG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15881R-3.in silico     181 AAGCTAAGGGAAAAGCGGGAGACCCAGCCGGATGATGTGGATACGGATAACCAGTTTAGG 240


15881R-3.IR_full       241 GCGGAGCAGCGCAAGTTGCGGGTTCTTCCAGGCCGAGCTCAATGTCGAGGACATCATTAA 300
                           ||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||
15881R-3.in silico     241 GCGGAGCAGCGCAAGCTGCGGGTTC-TCCAGGCCGAGCTCAATGTCGAGGACATCATTAA 300


15881R-3.IR_full       301 AGAGCGTTCCTACAAGACCTTCAATGAACGATGCCGGTCCTATTTTCATGCTGGCAGGNA 360
                           ||| ||||||||||||||||||||||||||||||||||||||||||||||||||      
15881R-3.in silico     301 AGATCGTTCCTACAAGACCTTCAATGAACGATGCCGGTCCTATTTTCATGCTGG------ 360


15881R-3.IR_full       361 CCA 363
                           |||
15881R-3.in silico     361 CCA 363

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   338  NM_140893.2  CG15881-RB, transcript variant B (CG15881), mRNA 
100   338  NM_168819.1  CG15881-RA, transcript variant A (CG15881), mRNA 
0   NM_176271.1  CG2469-RB, transcript variant B (CG2469), mRNA 
0   NM_176270.1  CG2469-RA, transcript variant A (CG2469), mRNA 
0   NM_176458.2  CG4509-RB (CG4509), mRNA 
0   NM_132199.2  CG2206-RA, transcript variant A (l(1)G0193), mRNA 
0   NM_206643.1  CG2206-RB, transcript variant B (l(1)G0193), mRNA 
0   NM_057685.3  CG11527-RA (Tig), mRNA 
0   NM_168188.1  CG14823-RC, transcript variant C (CG14823), mRNA 
0   NM_168187.1  CG14823-RB, transcript variant B (CG14823), mRNA 
0   NM_168186.1  CG14823-RA, transcript variant A (CG14823), mRNA 
0   NM_139817.2  CG14823-RD, transcript variant D (CG14823), mRNA 
0   11  NM_141297.1  CG2926-RA (CG2926), mRNA 
0   NM_136552.1  CG8642-RA (CG8642), mRNA 
0   NM_078545.2  CG12653-RA (btd), mRNA 
0   NM_135363.2  CG7806-RA (CG7806), mRNA 
0   NM_132962.1  CG8945-RC (CG8945), mRNA 
0   11  NM_079007.2  CG17716-RA (fas), mRNA 
0   NM_057262.2  CG1828-RA, transcript variant A (dre4), mRNA 
0   NM_167922.1  CG1828-RB, transcript variant B (dre4), mRNA 
0   NM_001043070.1  CG34146-RA (brp), mRNA 
0   NM_001043101.1  CG3682-RC, transcript variant C (PIP5K59B), mRNA 
0   NM_139981.2  CG6831-RA (rhea), mRNA 
0   NM_137885.2  CG3682-RA, transcript variant A (PIP5K59B), mRNA 
0   NM_132753.1  CG9514-RA (CG9514), mRNA 
0   NM_144355.2  CG5442-RB, transcript variant B (SC35), mRNA 
0   NM_136005.1  CG15144-RA (CG15144), mRNA 
0   NM_205967.1  CG5442-RA, transcript variant A (SC35), mRNA 
0   NM_139423.1  CG5690-RA (CG5690), mRNA 
0   NM_134861.1  CG2843-RA (CG2843), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.