National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 15872R-3 
 Symbol Gr59e  Full Name Gustatory receptor 59e 
 CG No CG33151  Old CG No CG15872 
 Synonyms Gr59E2, CG15872, 59E2, 59E.2, GR59E.2, CG33151, Gr59e 
 Accession No (Link to NCBI) NM_176251.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACTGGGAGAATCTGCTGCTGA 
 Primer Seq. 3'
aatctagaggtaccATACTGGAGCACCCCCAGACT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ACTGGGAGAA TCTGCTGCTG ACCATCAATC GGTTCCTGGG CGTGTATCCC AGTGGGAGAG 
0061 TGGGCGTACT CCGCTGGCTC CACACGCTCT GGAGCCTGTT CCTGCTTATG TACATCTGGA 
0121 CTGGCAGCAT TGTTAAGTGC TTGGAGTTCA CAGTGGAGAT ACCCACTATT GAAAAACTGC 
0181 TCTATCTGAT GGAGTTCCCT GGAAATATGG CCACCATTGC CATCCTGGTA TATTATGCCG 
0241 TATTGAACCG TCCACTTGCT CACGGAGCGG AGCTCCAGAT TGAGCGGATC ATCACAGGAC 
0301 TCAAAGGCAA AGCTAAGCGA ATGGTTTGTA AGAGACATAG TCAGAGGACT CTTCATCTGA 
0361 TGGCGACCAC TTTAGTCTTC CATGGCCTGT GTGTCCTGGT TGACGTGGTC AACTATGACT 
0421 TCGAGTTCTG GACCACTTGG AGCAGCAACA GTGTCTACAA TCTGCCTGGT CTAATGATGA 
0481 GTCTGGGGGT GCTCCAGTAT  
 in silico PCR Fragment
0001 ACTGGGAGAA TCTGCTGCTG ACCATCAATC GGTTCCTGGG CGTGTATCCC AGTGGGAGAG 
0061 TGGGCGTACT CCGCTGGCTC CACACGCTCT GGAGCCTGTT CCTGCTTATG TACATCTGGA 
0121 CTGGCAGCAT TGTTAAGTGC TTGGAGTTCA CAGTGGAGAT ACCCACTATT GAAAAACTGC 
0181 TCTATCTGAT GGAGTTCCCT GGAAATATGG CCACCATTGC CATCCTGGTA TACTATGCCG 
0241 TATTGAACCG TCCACTTGCT CACGGAGCGG AACTCCAGAT TGAGCGGATC ATCACAGGAC 
0301 TCAAAGGCAA AGCTAAGCGA CTGGTTTATA AGAGACATGG TCAGAGGACT CTTCATCTGA 
0361 TGGCGACCAC TTTAGTCTTC CATGGCCTGT GTGTCCTGGT TGACGTGGTC AACTATGACT 
0421 TCGAGTTCTG GACCACTTGG AGCAGTAACA GTGTCTACAA TTTGCCTGGT CTAATGATGA 
0481 GTCTGGGGGT GCTCCAGTAT  
 Assemble Data

15872R-3.IR_full       1   ACTGGGAGAATCTGCTGCTGACCATCAATCGGTTCCTGGGCGTGTATCCCAGTGGGAGAG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15872R-3.in silico     1   ACTGGGAGAATCTGCTGCTGACCATCAATCGGTTCCTGGGCGTGTATCCCAGTGGGAGAG 60


15872R-3.IR_full       61  TGGGCGTACTCCGCTGGCTCCACACGCTCTGGAGCCTGTTCCTGCTTATGTACATCTGGA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15872R-3.in silico     61  TGGGCGTACTCCGCTGGCTCCACACGCTCTGGAGCCTGTTCCTGCTTATGTACATCTGGA 120


15872R-3.IR_full       121 CTGGCAGCATTGTTAAGTGCTTGGAGTTCACAGTGGAGATACCCACTATTGAAAAACTGC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15872R-3.in silico     121 CTGGCAGCATTGTTAAGTGCTTGGAGTTCACAGTGGAGATACCCACTATTGAAAAACTGC 180


15872R-3.IR_full       181 TCTATCTGATGGAGTTCCCTGGAAATATGGCCACCATTGCCATCCTGGTATATTATGCCG 240
                           |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
15872R-3.in silico     181 TCTATCTGATGGAGTTCCCTGGAAATATGGCCACCATTGCCATCCTGGTATACTATGCCG 240


15872R-3.IR_full       241 TATTGAACCGTCCACTTGCTCACGGAGCGGAGCTCCAGATTGAGCGGATCATCACAGGAC 300
                           ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
15872R-3.in silico     241 TATTGAACCGTCCACTTGCTCACGGAGCGGAACTCCAGATTGAGCGGATCATCACAGGAC 300


15872R-3.IR_full       301 TCAAAGGCAAAGCTAAGCGAATGGTTTGTAAGAGACATAGTCAGAGGACTCTTCATCTGA 360
                           |||||||||||||||||||| |||||| |||||||||| |||||||||||||||||||||
15872R-3.in silico     301 TCAAAGGCAAAGCTAAGCGACTGGTTTATAAGAGACATGGTCAGAGGACTCTTCATCTGA 360


15872R-3.IR_full       361 TGGCGACCACTTTAGTCTTCCATGGCCTGTGTGTCCTGGTTGACGTGGTCAACTATGACT 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15872R-3.in silico     361 TGGCGACCACTTTAGTCTTCCATGGCCTGTGTGTCCTGGTTGACGTGGTCAACTATGACT 420


15872R-3.IR_full       421 TCGAGTTCTGGACCACTTGGAGCAGCAACAGTGTCTACAATCTGCCTGGTCTAATGATGA 480
                           ||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||
15872R-3.in silico     421 TCGAGTTCTGGACCACTTGGAGCAGTAACAGTGTCTACAATTTGCCTGGTCTAATGATGA 480


15872R-3.IR_full       481 GTCTGGGGGTGCTCCAGTAT 500
                           ||||||||||||||||||||
15872R-3.in silico     481 GTCTGGGGGTGCTCCAGTAT 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_176251.1  CG33151-RA (Gr59e), mRNA 
0   10  NM_140901.2  CG7762-RA (Rpn1), mRNA 
0   NM_078542.4  CG15371-RA (Gr8a), mRNA 
0   NM_139396.3  CG2069-RA (Oseg4), mRNA 
0   NM_136296.1  CG5922-RA (CG5922), mRNA 
0   NM_206056.2  CG8715-RC, transcript variant C (lig), mRNA 
0   NM_136504.3  CG8715-RA, transcript variant A (lig), mRNA 
0   NM_001014503.1  CG8715-RD, transcript variant D (lig), mRNA 
0   NM_165586.2  CG8715-RB, transcript variant B (lig), mRNA 
0   NM_165693.2  CG30004-RA (CG30004), mRNA 
0   NM_165858.2  CG30036-RA (CG30036), mRNA 
0   NM_206200.1  CG11206-RB, transcript variant B (CG11206), mRNA 
0   NM_137819.2  CG11206-RA, transcript variant A (CG11206), mRNA 
0   NM_142457.2  CG7669-RA (CG7669), mRNA 
0   NM_136079.2  CG10639-RA (CG10639), mRNA 
0   NM_143760.2  CG32464-RB, transcript variant B (l(3)82Fd), mRNA 
0   NM_001043213.1  CG32464-RP, transcript variant P (l(3)82Fd), mRNA 
0   NM_169039.2  CG32464-RL, transcript variant L (l(3)82Fd), mRNA 
0   NM_001031977.1  CG32464-RN, transcript variant N (l(3)82Fd), mRNA 
0   NM_169038.1  CG32464-RJ, transcript variant J (l(3)82Fd), mRNA 
0   NM_206429.1  CG32464-RG, transcript variant G (l(3)82Fd), mRNA 
0   NM_170640.2  CG32464-RK, transcript variant K (l(3)82Fd), mRNA 
0   NM_141962.1  CG6753-RA (CG6753), mRNA 
0   NM_001043214.1  CG32464-RO, transcript variant O (l(3)82Fd), mRNA 
0   NM_169047.1  CG32464-RD, transcript variant D (l(3)82Fd), mRNA 
0   NM_170641.1  CG32464-RF, transcript variant F (l(3)82Fd), mRNA 
0   NM_001031978.1  CG32464-RM, transcript variant M (l(3)82Fd), mRNA 
0   NM_142970.2  CG5515-RA, transcript variant A (CG5515), mRNA 
0   NM_166189.1  CG30463-RB, transcript variant B (CG30463), mRNA 
0   NM_166188.1  CG30463-RA, transcript variant A (CG30463), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.