National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 15717R-1 
 Symbol CG15717  Full Name CG15717 
 CG No CG15717  Old CG No CG15717 
 Synonyms CG15717 
 Accession No (Link to NCBI) NM_132628.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol. (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACCAGCTACATGGTCAACCAG 
 Primer Seq. 3'
aatctagaggtaccCACAGACTAACTTGGCCGTAA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ACCAGCTACA TGGTCAACCA GCTGCAGCCG ACGGCGCAGG AAACGAAGTT GGCGCTGATT 
0061 CCCAGTGCAC CCCAGTGGCG CTCCCCCCAG CTGATGGTCG TCTTCGAGGA CGGTGATCTG 
0121 CACTCAGCGC GCCACCAGTT GCTCCAGTCC CTGCAGAATC CCTTTGCCGA GGGATCGGTG 
0181 GCCACGTTGC TACTCCAGGA GAGCATTGCC GATCAGTTTG TGGGCCTAGT GGCGCAGGAT 
0241 TTGCGTCCGT TGTCGCAGGA GGTGTCCAAG CATCCGAGCT ACACCAGCAC GCTGGCCAAG 
0301 ATCGAAGAGC TGAAGGCCAA GACAGTACAA GGCGAAAgCC TTAAGGCTGG GGAATCACCC 
0361 GTCTTGGTGT ACGACTGCGT GCACAGCTAT CTGGGCAATG GAGCGACGGG AGTGGTGACG 
0421 GTGCACACAT TCCGCACAGC CAAGGAGGCC GGCCAGTTGG CCAAAAGGGA TCCCCTACCT 
0481 TACGGCCAAG TTAGTCTGTG  
 in silico PCR Fragment
0001 ACCAGCTACA TGGTCAACCA GCTGCAGCCG ACGGCGCAGG AAACGAAGTT GGCGCTGATT 
0061 CCCAGTGCAC CCCAGTGGCG CTCCCCCCAG CTGATGGTCG TCTTCGAGGA CGGTGATCTG 
0121 CACTCAGCGC GCCACCAGTT GCTCCAGTCC CTGCAGAATC CCTTTGCCGA GGGATCGGTG 
0181 GCCACGTTGC TACTCCAGGA GAGCATTGCC GATCAGTTTG TGGGCCTAGT GGCGCAGGAT 
0241 TTGCGTCCGT TGTCGCAGGA GGTGTCCAAG CATCCGAGCT ACACCAGCAC GCTGGCCAAG 
0301 ATCGAAGAGC TGAAGGCCAA GACAGTACAA GGCGAAAGCC TTAAGGCTGG GGAATCACCC 
0361 GTCTTGGTGT ACGACTGCGT GCACAGCTAT CTGGGCAATG GAGCGACGGG AGTGGTGACG 
0421 GTGCACACAT TCCGCACAGC CAAGGAGGCC GGCCAGTTGG CCAAAAGGGA TCCCCTACCT 
0481 TACGGCCAAG TTAGTCTGTG  
 Assemble Data

15717R-1.IR_full       1   ACCAGCTACATGGTCAACCAGCTGCAGCCGACGGCGCAGGAAACGAAGTTGGCGCTGATT 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15717R-1.in silico     1   ACCAGCTACATGGTCAACCAGCTGCAGCCGACGGCGCAGGAAACGAAGTTGGCGCTGATT 60


15717R-1.IR_full       61  CCCAGTGCACCCCAGTGGCGCTCCCCCCAGCTGATGGTCGTCTTCGAGGACGGTGATCTG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15717R-1.in silico     61  CCCAGTGCACCCCAGTGGCGCTCCCCCCAGCTGATGGTCGTCTTCGAGGACGGTGATCTG 120


15717R-1.IR_full       121 CACTCAGCGCGCCACCAGTTGCTCCAGTCCCTGCAGAATCCCTTTGCCGAGGGATCGGTG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15717R-1.in silico     121 CACTCAGCGCGCCACCAGTTGCTCCAGTCCCTGCAGAATCCCTTTGCCGAGGGATCGGTG 180


15717R-1.IR_full       181 GCCACGTTGCTACTCCAGGAGAGCATTGCCGATCAGTTTGTGGGCCTAGTGGCGCAGGAT 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15717R-1.in silico     181 GCCACGTTGCTACTCCAGGAGAGCATTGCCGATCAGTTTGTGGGCCTAGTGGCGCAGGAT 240


15717R-1.IR_full       241 TTGCGTCCGTTGTCGCAGGAGGTGTCCAAGCATCCGAGCTACACCAGCACGCTGGCCAAG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15717R-1.in silico     241 TTGCGTCCGTTGTCGCAGGAGGTGTCCAAGCATCCGAGCTACACCAGCACGCTGGCCAAG 300


15717R-1.IR_full       301 ATCGAAGAGCTGAAGGCCAAGACAGTACAAGGCGAAAGCCTTAAGGCTGGGGAATCACCC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15717R-1.in silico     301 ATCGAAGAGCTGAAGGCCAAGACAGTACAAGGCGAAAGCCTTAAGGCTGGGGAATCACCC 360


15717R-1.IR_full       361 GTCTTGGTGTACGACTGCGTGCACAGCTATCTGGGCAATGGAGCGACGGGAGTGGTGACG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15717R-1.in silico     361 GTCTTGGTGTACGACTGCGTGCACAGCTATCTGGGCAATGGAGCGACGGGAGTGGTGACG 420


15717R-1.IR_full       421 GTGCACACATTCCGCACAGCCAAGGAGGCCGGCCAGTTGGCCAAAAGGGATCCCCTACCT 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15717R-1.in silico     421 GTGCACACATTCCGCACAGCCAAGGAGGCCGGCCAGTTGGCCAAAAGGGATCCCCTACCT 480


15717R-1.IR_full       481 TACGGCCAAGTTAGTCTGTG 500
                           ||||||||||||||||||||
15717R-1.in silico     481 TACGGCCAAGTTAGTCTGTG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_132628.2  CG15717-RA (CG15717), mRNA 
0   NM_130666.2  CG2681-RA (CG2681), mRNA 
0   NM_168369.1  CG8177-RG, transcript variant G (CG8177), mRNA 
0   NM_168372.1  CG8177-RF, transcript variant F (CG8177), mRNA 
0   NM_168371.1  CG8177-RC, transcript variant C (CG8177), mRNA 
0   NM_206314.1  CG8177-RH, transcript variant H (CG8177), mRNA 
0   NM_206311.1  CG8177-RK, transcript variant K (CG8177), mRNA 
0   NM_206312.1  CG8177-RJ, transcript variant J (CG8177), mRNA 
0   NM_206313.1  CG8177-RI, transcript variant I (CG8177), mRNA 
0   NM_140100.1  CG8177-RA, transcript variant A (CG8177), mRNA 
0   NM_168370.1  CG8177-RB, transcript variant B (CG8177), mRNA 
0   NM_168373.1  CG8177-RE, transcript variant E (CG8177), mRNA 
0   NM_168374.1  CG8177-RD, transcript variant D (CG8177), mRNA 
0   NM_140267.1  CG14126-RA (CG14126), mRNA 
0   NM_135258.1  CG4497-RA (CG4497), mRNA 
0   NM_079874.2  CG2098-RA, transcript variant A (ferrochelatase), mRNA 
0   NM_170580.2  CG2098-RB, transcript variant B (ferrochelatase), mRNA 
0   NM_170579.2  CG2098-RC, transcript variant C (ferrochelatase), mRNA 
0   16  NM_143358.1  CG12516-RA (CG12516), mRNA 
0   NM_142495.1  CG14299-RA, transcript variant A (CG14299), mRNA 
0   NM_132086.1  CG15894-RA (CG15894), mRNA 
0   NM_165582.1  CG8722-RB, transcript variant B (Nup44A), mRNA 
0   NM_165583.1  CG8722-RC, transcript variant C (Nup44A), mRNA 
0   NM_136499.2  CG8722-RA, transcript variant A (Nup44A), mRNA 
0   NM_140023.2  CG5093-RA (Doc3), mRNA 
0   NM_166955.2  CG3588-RC, transcript variant C (CG3588), mRNA 
0   NM_001031868.1  CG3588-RD, transcript variant D (CG3588), mRNA 
0   NM_130680.2  CG3588-RB, transcript variant B (CG3588), mRNA 
0   NM_166956.3  CG3588-RA, transcript variant A (CG3588), mRNA 
0   NM_136554.2  CG14750-RA (Vps25), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
 
DM
 
VM
 
VB
 
Caspase-3 signal
N
 
DB
 
DC
DM
 
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.