National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 15509R-2 
 Symbol kay  Full Name kayak 
 CG No CG33956  Old CG No CG15509 
 Synonyms CG15509, CG15507, DFos, AP-1, Dfos, DFOS, D-fos, D-Fos, fos, Fos, AP1, d-fos, c-Fos, sro, dFRA, dFos, Fra, DFra, dFra, dAP-1, dlhD, CG33956, kay, D-fos/kay 
 Accession No (Link to NCBI) NM_001032407.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Ling J, Dubruille R, Emery P.
KAYAK-α modulates circadian transcriptional feedback loops in Drosophila pacemaker neurons.
J. Neurosci. (2012) 32(47) 16959-70 [ PubMed ID = 23175847 ] [ RRC reference ]

Brock AR, Wang Y, Berger S, Renkawitz-Pohl R, Han VC, Wu Y, Galko MJ.
Transcriptional regulation of Profilin during wound closure in Drosophila larvae.
J. Cell. Sci. (2012) 125(Pt 23) 5667-76 [ PubMed ID = 22976306 ] [ RRC reference ]

Lesch C, Jo J, Wu Y, Fish GS, Galko MJ.
A targeted UAS-RNAi screen in Drosophila larvae identifies wound closure genes regulating distinct cellular processes.
Genetics (2010) 186(3) 943-57 [ PubMed ID = 20813879 ] [ RRC reference ]

Ohhara Y, Nakamura A, Kato Y, Yamakawa-Kobayashi K.
Chaperonin TRiC/CCT supports mitotic exit and entry into endocycle in Drosophila.
PLoS Genet. (2019) 15(4) e1008121 [ PubMed ID = 31034473 ] [ RRC reference ]

Nitta Y, Yamazaki D, Sugie A, Hiroi M, Tabata T.
DISCO Interacting Protein 2 regulates axonal bifurcation and guidance of Drosophila mushroom body neurons.
Dev. Biol. (2017) 421(2) 233-244 [ PubMed ID = 27908785 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCGCCATCAGAAAGCCCGAGGA 
 Primer Seq. 3'
aatctagaggtaccAGTTGTTGACACCGCCGCCGT 
 Predicted Fragment Size
596 
 IR fragment full Seq
0001 CGCCATCAGA AAGCCCGAGG ATCCAGATCC GGCGGAAGAG GACAGGGTCA AGATGGTGCA 
0061 GGATGACCCA GAGGACCAGG AGAACCAGGC GGTGGATGAG GAGGAGCTGG ACTTTCTGCC 
0121 CGCCGATCTA AGCGCTGCGA TATCGACGGC GACAACGAAA ATAGCAACAC CGACGCGCAA 
0181 TCTTATCCTC GGCAACTTTG AGACCGGCCA GAGTGTTCTC ACACTGACGA CGCCCACGTT 
0241 GACGCCGACC ACCACGCGCA ACATCGAGGA CACACTGGGC CACTTGCTCT CGGACACGCA 
0301 GACCGATCGT GTGGCTGGTT GCGCGGGATT TGCAGTGCCA AAGGTGCTAC CCAATGCCAT 
0361 TGATGTCCTG GGCATGGGTA TTCCCACCGG TGTTTCGTCG CTCCCACTTC AGCAGACATT 
0421 CGATTTGAGC CTGGGGCAGG GCAGCGAGTC CGAGGACTCC AACGCTTCGT ACAACGATAC 
0481 GCAGATGAAC GAGGAGCAGG ACACGACCGA TACTTCAAGT GCCCATACGG ACAGCACCTC 
0541 GTACCAAGCT GGCCACATCA TGGCGGGCAG CGTGAACGGC GGCGGTGTCA ACAACT 
 in silico PCR Fragment
0001 CGCCATCAGA AAGCCCGAGG ATCCAGATCC GGCGGAAGAG GACAGGGTCA AGATGGTGCA 
0061 GGATGACCCA GAGGACCAGG AGAACCAGGC GGTGGATGAG GAGGAGCTGG ACTTTCTGCC 
0121 CGCCGATCTA AGCGCTGCGA TATCGACGGC GACAACGAAA ATAGCAACAC CGACGCGCAA 
0181 TCTTATCCTC GGCAACTTTG AGACCGGCCA GAGTGTTCTC ACACTGACGA CGCCCACGTT 
0241 GACGCCGACC ACCACGCGCA ACATCGAGGA CACACTGGGC CACTTGCTCT CGGACACGCA 
0301 GACCGATCGT GTGGCTGGTT GCGCGGGATT TGCAGTGCCA AAGGTGCTAC CCAATGCCAT 
0361 TGATGTCCTG GGCATGGGTA TTCCCACCGG TGTTTCGTCG CTCCCACTTC AGCAGACATT 
0421 CGATTTGAGC CTGGGGCAGG GCAGCGAGTC CGAGGACTCC AACGCTTCGT ACAACGATAC 
0481 GCAGATGAAC GAGGAGCAGG ACACGACCGA TACTTCAAGT GCCCATACGG ACAGCACCTC 
0541 GTACCAAGCT GGCCACATCA TGGCGGGCAG CGTGAACGGC GGCGGTGTCA ACAACT 
 Assemble Data

15509R-2.IR_full       1   CGCCATCAGAAAGCCCGAGGATCCAGATCCGGCGGAAGAGGACAGGGTCAAGATGGTGCA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15509R-2.in silico     1   CGCCATCAGAAAGCCCGAGGATCCAGATCCGGCGGAAGAGGACAGGGTCAAGATGGTGCA 60


15509R-2.IR_full       61  GGATGACCCAGAGGACCAGGAGAACCAGGCGGTGGATGAGGAGGAGCTGGACTTTCTGCC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15509R-2.in silico     61  GGATGACCCAGAGGACCAGGAGAACCAGGCGGTGGATGAGGAGGAGCTGGACTTTCTGCC 120


15509R-2.IR_full       121 CGCCGATCTAAGCGCTGCGATATCGACGGCGACAACGAAAATAGCAACACCGACGCGCAA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15509R-2.in silico     121 CGCCGATCTAAGCGCTGCGATATCGACGGCGACAACGAAAATAGCAACACCGACGCGCAA 180


15509R-2.IR_full       181 TCTTATCCTCGGCAACTTTGAGACCGGCCAGAGTGTTCTCACACTGACGACGCCCACGTT 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15509R-2.in silico     181 TCTTATCCTCGGCAACTTTGAGACCGGCCAGAGTGTTCTCACACTGACGACGCCCACGTT 240


15509R-2.IR_full       241 GACGCCGACCACCACGCGCAACATCGAGGACACACTGGGCCACTTGCTCTCGGACACGCA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15509R-2.in silico     241 GACGCCGACCACCACGCGCAACATCGAGGACACACTGGGCCACTTGCTCTCGGACACGCA 300


15509R-2.IR_full       301 GACCGATCGTGTGGCTGGTTGCGCGGGATTTGCAGTGCCAAAGGTGCTACCCAATGCCAT 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15509R-2.in silico     301 GACCGATCGTGTGGCTGGTTGCGCGGGATTTGCAGTGCCAAAGGTGCTACCCAATGCCAT 360


15509R-2.IR_full       361 TGATGTCCTGGGCATGGGTATTCCCACCGGTGTTTCGTCGCTCCCACTTCAGCAGACATT 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15509R-2.in silico     361 TGATGTCCTGGGCATGGGTATTCCCACCGGTGTTTCGTCGCTCCCACTTCAGCAGACATT 420


15509R-2.IR_full       421 CGATTTGAGCCTGGGGCAGGGCAGCGAGTCCGAGGACTCCAACGCTTCGTACAACGATAC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15509R-2.in silico     421 CGATTTGAGCCTGGGGCAGGGCAGCGAGTCCGAGGACTCCAACGCTTCGTACAACGATAC 480


15509R-2.IR_full       481 GCAGATGAACGAGGAGCAGGACACGACCGATACTTCAAGTGCCCATACGGACAGCACCTC 540
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15509R-2.in silico     481 GCAGATGAACGAGGAGCAGGACACGACCGATACTTCAAGTGCCCATACGGACAGCACCTC 540


15509R-2.IR_full       541 GTACCAAGCTGGCCACATCATGGCGGGCAGCGTGAACGGCGGCGGTGTCAACAACT 596
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15509R-2.in silico     541 GTACCAAGCTGGCCACATCATGGCGGGCAGCGTGAACGGCGGCGGTGTCAACAACT 596

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   578  NM_001032407.1  CG33956-RA, transcript variant A (kay), mRNA 
67.64   391  NM_001032406.1  CG33956-RB, transcript variant B (kay), mRNA 
67.64   391  NM_001032405.1  CG33956-RE, transcript variant E (kay), mRNA 
67.64   391  NM_001032408.1  CG33956-RD, transcript variant D (kay), mRNA 
0.51   NM_143348.2  CG4849-RA (CG4849), mRNA 
0.51   NM_170363.1  CG31054-RA (CG31054), mRNA 
0.17   NM_135461.2  CG4364-RA (CG4364), mRNA 
0   NM_137821.2  CG10955-RA (CG10955), mRNA 
0   NM_139904.1  CG8281-RA (CG8281), mRNA 
0   NM_132346.1  CG3003-RB (CG3003), mRNA 
0   NM_170651.3  CG17077-RD, transcript variant D (pnt), mRNA 
0   NM_170070.1  CG17077-RC, transcript variant C (pnt), mRNA 
0   NM_079737.2  CG17077-RB, transcript variant B (pnt), mRNA 
0   NM_143969.1  CG17208-RA (CG17208), mRNA 
0   NM_136982.2  CG3850-RA (sug), mRNA 
0   NM_079717.2  CG6703-RB, transcript variant B (Caki), mRNA 
0   NM_145193.1  CG30185-RA (CG30185), mRNA 
0   12  NM_166125.2  CG18255-RA, transcript variant A (Strn-Mlck), mRNA 
0   12  NM_166126.1  CG18255-RC, transcript variant C (Strn-Mlck), mRNA 
0   11  NM_134516.2  CG32529-RA, transcript variant A (CG32529), mRNA 
0   NM_166129.2  CG18255-RD, transcript variant D (Strn-Mlck), mRNA 
0   NM_166130.1  CG18255-RE, transcript variant E (Strn-Mlck), mRNA 
0   NM_169790.1  CG7913-RA, transcript variant A (PP2A-B'), mRNA 
0   NM_169789.1  CG7913-RB, transcript variant B (PP2A-B'), mRNA 
0   NM_169022.1  CG31536-RA, transcript variant A (Cdep), mRNA 
0   NM_001043211.1  CG31536-RE, transcript variant E (Cdep), mRNA 
0   NM_169023.1  CG31536-RB, transcript variant B (Cdep), mRNA 
0   NM_169088.1  CG1250-RA, transcript variant A (sec23), mRNA 
0   NM_169089.2  CG1250-RB, transcript variant B (sec23), mRNA 
0   NM_176133.3  CG12052-RI, transcript variant I (lola), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.