National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 15454R-2 
 Symbol CG15454  Full Name CG15454 
 CG No CG15454  Old CG No CG15454 
 Synonyms CG15454 
 Accession No (Link to NCBI) NM_134555.1 
 Inserted Chr.
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCCACGAGCGGTACGCAGCTTA 
 Primer Seq. 3'
aatctagaggtaccCGGCAAGAGGGGACTTTGCAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CCACGAGCGG TACGCAGCTT AGCGCCTTTG TCCAGCCACC AATGACGTCA TCGCCACCGC 
0061 CGGTCACCAG TTTGCAGCAT GACAATAATA ATAACAACAG CAACAACAAC AACAGCAGCA 
0121 GTCACATTGA TGCGGGTTTC GAAAGCGACA GCATTTCGGT AACAGGATCG CCGCGAAAAA 
0181 GCCTCGGCTC CCCTTTGACC CACGACGAGG AGGAGGCAGA GGCAGAAGCT GAAGCTGAAG 
0241 CAGAAGCAGA GGCGGAGGCT GAGGAAGCGG AGGTGGGCGG ATTAAGTCGG AATGGTGGCG 
0301 GCATTCAGGG CCCGCTGCAC AGCGAAAGTT CCCCGGGCTC GGGTGGCGCC TTCACCGCCC 
0361 TCATCCAGCG AAGTGGCAAA AATCCCACCG AATTATTCGG CGGCTTTGCC GCTGCAGGTG 
0421 GAAATCACTT TGCACCCAGC GGTCATAGTT TCAATCCCGC TCTGGCCGCC CAACTCTTCC 
0481 TGCAAAGTCC CCTCTTGCCG  
 in silico PCR Fragment
0001 CCACGAGCGG TACGCAGCTT AGCGCCTTTG TCCAGCCACC AATGACGTCA TCGCCACCGC 
0061 CGGTCACCAG TTTGCAGCAT GACAATAATA ATAACAACAG CAACAACAAC AACAGCAGCA 
0121 GTCACATTGA TGCGGGTTTC GAAAGCGACA GCATTTCGGT AACAGGATCG CCGCGAAAAA 
0181 GCCTCGGCTC CCCTTTGACC CACGACGAGG AGGAGGCAGA GGCAGAAGCT GAAGCTGAAG 
0241 CAGAAGCAGA GGCGGAGGCT GAGGAAGCGG AGGTGGGCGG ATTAAGTCGG AATGGTGGCG 
0301 GCATTCAGGG CCCGCTGCAC AGCGAAAGTT CCCCGGGCTC GGGTGGCGCC TTCACCGCCC 
0361 TCATCCAGCG AAGTGGCAAA AATCCCACCG AATTATTCGG CGGCTTTGCC GCTGCAGGTG 
0421 GAAATCACTT TGCACCCAGC GGTCATAGTT TCAATCCCGC TCTGGCCGCC CAACTCTTCC 
0481 TGCAAAGTCC CCTCTTGCCG  
 Assemble Data

15454R-2.IR_full       1   CCACGAGCGGTACGCAGCTTAGCGCCTTTGTCCAGCCACCAATGACGTCATCGCCACCGC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15454R-2.in silico     1   CCACGAGCGGTACGCAGCTTAGCGCCTTTGTCCAGCCACCAATGACGTCATCGCCACCGC 60


15454R-2.IR_full       61  CGGTCACCAGTTTGCAGCATGACAATAATAATAACAACAGCAACAACAACAACAGCAGCA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15454R-2.in silico     61  CGGTCACCAGTTTGCAGCATGACAATAATAATAACAACAGCAACAACAACAACAGCAGCA 120


15454R-2.IR_full       121 GTCACATTGATGCGGGTTTCGAAAGCGACAGCATTTCGGTAACAGGATCGCCGCGAAAAA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15454R-2.in silico     121 GTCACATTGATGCGGGTTTCGAAAGCGACAGCATTTCGGTAACAGGATCGCCGCGAAAAA 180


15454R-2.IR_full       181 GCCTCGGCTCCCCTTTGACCCACGACGAGGAGGAGGCAGAGGCAGAAGCTGAAGCTGAAG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15454R-2.in silico     181 GCCTCGGCTCCCCTTTGACCCACGACGAGGAGGAGGCAGAGGCAGAAGCTGAAGCTGAAG 240


15454R-2.IR_full       241 CAGAAGCAGAGGCGGAGGCTGAGGAAGCGGAGGTGGGCGGATTAAGTCGGAATGGTGGCG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15454R-2.in silico     241 CAGAAGCAGAGGCGGAGGCTGAGGAAGCGGAGGTGGGCGGATTAAGTCGGAATGGTGGCG 300


15454R-2.IR_full       301 GCATTCAGGGCCCGCTGCACAGCGAAAGTTCCCCGGGCTCGGGTGGCGCCTTCACCGCCC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15454R-2.in silico     301 GCATTCAGGGCCCGCTGCACAGCGAAAGTTCCCCGGGCTCGGGTGGCGCCTTCACCGCCC 360


15454R-2.IR_full       361 TCATCCAGCGAAGTGGCAAAAATCCCACCGAATTATTCGGCGGCTTTGCCGCTGCAGGTG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15454R-2.in silico     361 TCATCCAGCGAAGTGGCAAAAATCCCACCGAATTATTCGGCGGCTTTGCCGCTGCAGGTG 420


15454R-2.IR_full       421 GAAATCACTTTGCACCCAGCGGTCATAGTTTCAATCCCGCTCTGGCCGCCCAACTCTTCC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15454R-2.in silico     421 GAAATCACTTTGCACCCAGCGGTCATAGTTTCAATCCCGCTCTGGCCGCCCAACTCTTCC 480


15454R-2.IR_full       481 TGCAAAGTCCCCTCTTGCCG 500
                           ||||||||||||||||||||
15454R-2.in silico     481 TGCAAAGTCCCCTCTTGCCG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  32  81  NM_134555.1  CG15454-RA (CG15454), mRNA 
3.73   18  110  312  509  NM_168571.2  CG32133-RA (CG32133), mRNA 
3.11   15  59  282  787  NM_080536.2  CG4013-RA, transcript variant A (Smr), mRNA 
3.11   15  59  282  787  NM_167334.1  CG4013-RB, transcript variant B (Smr), mRNA 
3.11   15  59  282  787  NM_167335.1  CG4013-RC, transcript variant C (Smr), mRNA 
2.07   10  49  150  297  NM_078592.2  CG11172-RA (NFAT), mRNA 
2.07   10  10  110  209  NM_176556.1  CG33106-RA, transcript variant A (mask), mRNA 
2.07   10  10  110  209  NM_176557.1  CG33106-RB, transcript variant B (mask), mRNA 
1.86   31  91  NM_132116.1  CG14441-RA (CG14441), mRNA 
1.86   42  111  NM_133124.1  CG7502-RA (CG7502), mRNA 
1.65   20  53  169  NM_142210.1  CG6118-RA (CG6118), mRNA 
1.65   18  58  150  NM_142597.2  CG12254-RA (MED25), mRNA 
1.65   41  143  NM_168681.2  CG3849-RB, transcript variant B (Lasp), mRNA 
1.65   13  43  NM_131968.2  CG32772-RA (CG32772), mRNA 
1.45   22  96  252  NM_143409.1  CG11873-RA (CG11873), mRNA 
1.45   20  43  175  NM_168237.1  CG17888-RD, transcript variant D (Pdp1), mRNA 
1.45   20  79  NM_135957.2  CG31738-RB, transcript variant B (CG31738), mRNA 
1.45   14  39  NM_165168.1  CG31738-RA, transcript variant A (CG31738), mRNA 
1.24   60  146  181  NM_168240.1  CG32365-RA (CG32365), mRNA 
1.24   46  146  386  NM_079671.2  CG7847-RA, transcript variant A (sr), mRNA 
1.24   46  144  336  NM_169786.1  CG7847-RB, transcript variant B (sr), mRNA 
1.24   42  112  204  NM_135615.2  CG6700-RA (CG6700), mRNA 
1.24   30  57  141  NM_140424.1  CG9007-RA (CG9007), mRNA 
1.24   19  98  240  NM_078717.2  CG3696-RA, transcript variant A (kis), mRNA 
1.24   14  96  254  NM_167000.1  CG32778-RA (CG32778), mRNA 
1.24   11  23  48  NM_142868.1  CG13830-RA (CG13830), mRNA 
1.24   16  37  NM_130589.1  CG14801-RB, transcript variant B (CG14801), mRNA 
1.24   16  31  NM_166906.1  CG14801-RA, transcript variant A (CG14801), mRNA 
1.24   16  31  NM_166907.1  CG14801-RC, transcript variant C (CG14801), mRNA 
1.24   16  31  NM_166908.1  CG14801-RD, transcript variant D (CG14801), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.