National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 15395R-2 
 Symbol CG15395  Full Name CG15395 
 CG No CG15395  Old CG No CG15395 
 Synonyms CG15395 
 Accession No (Link to NCBI) NM_134852.1 
 Inserted Chr. lll 
 Insertional Mutation  semi-lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGTGGAGTCGATGGAGAGCTTT 
 Primer Seq. 3'
aatctagaggtaccCTAGGAGCCTGCATTTTGTGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 NTGGAGTCGA TGGAGAGCTT TgNATCCGCA ATAAGTGAGG AGTTTCCCAG ACTCCAACAG 
0061 CATCGTGAGC AGGTGGAGCA GCTGCAGCGA NCGCGGCAGG CAGATTGTCA GCCAGGCCCA 
0121 GCAGCATTCT CAGGTTTTGG TCTCCAATCT GTTCAAGAAT ATGAAGATCT CGTGCGAGAA 
0181 GCCCACATTT CCACCGCAGG TGTCGNGCTN CCAAANGGCC TATCGCTTCA AGGACATCTA 
0241 TTCCAGTCGC AAGGATCAGC TGATCCGCGA ATGCAGGGAG CAGGAgcGCA AGCAGCGCGA 
0301 GTTCCACAGC CGACCGATgN CCGAcTTTCG TCAGGCGCAc TCACGTCAGT CCTCCAGGGT 
0361 CGTTGTGCAT CGGATCACCT GCCCCACGAC CCCCAATGTG CTCAAGAATT CGCGTGAAAT 
0421 GGAGGAAAAG CGcCGCTTGC GGGTGGAGCA GCTGCAGAGG GAGCGCGAGC TGGAGTCCCA 
0481 ACTTCACAAA ATGCAGGCTC CTAN 
 in silico PCR Fragment
0001 GTGGAGTCGA TGGAGAGCTT TGCATCCGCA ATAAGTGAGG AGTTTCCCAG ACTCCAACAG 
0061 CATCGTGAGC AGGTGGAGCA GCTGCAGCGA -CGCGGCAGG CAGATTGTCA GCCAGGCCCA 
0121 GCAGCATTCT CAGGTTTTGG TCTCCAATCT GTTCAAGAAT ATGAAGATCT CGTGCGAGAA 
0181 GCCCACATTT CCACCGCAGG TGTCG-GCT- CCAAA-GGCC TATCGCTTCA AGGACATCTA 
0241 TTCCAGTCGC AAGGATCAGC TGATCCGCGA ATGCAGGGAG CAGGAGCGCA AGCAGCGCGA 
0301 GTTCCACAGC CGACCGATGC CCGACTTTCG TCAGGCGCAC TCACGTCAGT CCTCCAGGGT 
0361 CGTTGTGCAT CGGATCACCT GCCCCACGAC CCCCAATGTG CTCAAGAATT CGCGTGAAAT 
0421 GGAGGAAAAG CGCCGCTTGC GGGTGGAGCA GCTGCAGAGG GAGCGCGAGC TGGAGTCCCA 
0481 ACTTCACAAA ATGCAGGCTC CTAG 
 Assemble Data

15395R-2.IR_full        1   TGGAGTCGATGGAGAGCTTTGNATCCGCAATAAGTGAGGAGTTTCCCAGACTCCAACAG 59
                            ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
15395R-2.in silico      1   TGGAGTCGATGGAGAGCTTTGCATCCGCAATAAGTGAGGAGTTTCCCAGACTCCAACAG 59


15395R-2.IR_full       61  CATCGTGAGCAGGTGGAGCAGCTGCAGCGANCGCGGCAGGCAGATTGTCAGCCAGGCCCA 119
                           |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
15395R-2.in silico     61  CATCGTGAGCAGGTGGAGCAGCTGCAGCGA-CGCGGCAGGCAGATTGTCAGCCAGGCCCA 119


15395R-2.IR_full       121 GCAGCATTCTCAGGTTTTGGTCTCCAATCTGTTCAAGAATATGAAGATCTCGTGCGAGAA 179
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15395R-2.in silico     121 GCAGCATTCTCAGGTTTTGGTCTCCAATCTGTTCAAGAATATGAAGATCTCGTGCGAGAA 179


15395R-2.IR_full       181 GCCCACATTTCCACCGCAGGTGTCGNGCTNCCAAANGGCCTATCGCTTCAAGGACATCTA 239
                           ||||||||||||||||||||||||| ||| ||||| ||||||||||||||||||||||||
15395R-2.in silico     181 GCCCACATTTCCACCGCAGGTGTCG-GCT-CCAAA-GGCCTATCGCTTCAAGGACATCTA 239


15395R-2.IR_full       241 TTCCAGTCGCAAGGATCAGCTGATCCGCGAATGCAGGGAGCAGGAGCGCAAGCAGCGCGA 299
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15395R-2.in silico     241 TTCCAGTCGCAAGGATCAGCTGATCCGCGAATGCAGGGAGCAGGAGCGCAAGCAGCGCGA 299


15395R-2.IR_full       301 GTTCCACAGCCGACCGATGNCCGACTTTCGTCAGGCGCACTCACGTCAGTCCTCCAGGGT 359
                           ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
15395R-2.in silico     301 GTTCCACAGCCGACCGATGCCCGACTTTCGTCAGGCGCACTCACGTCAGTCCTCCAGGGT 359


15395R-2.IR_full       361 CGTTGTGCATCGGATCACCTGCCCCACGACCCCCAATGTGCTCAAGAATTCGCGTGAAAT 419
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15395R-2.in silico     361 CGTTGTGCATCGGATCACCTGCCCCACGACCCCCAATGTGCTCAAGAATTCGCGTGAAAT 419


15395R-2.IR_full       421 GGAGGAAAAGCGCCGCTTGCGGGTGGAGCAGCTGCAGAGGGAGCGCGAGCTGGAGTCCCA 479
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15395R-2.in silico     421 GGAGGAAAAGCGCCGCTTGCGGGTGGAGCAGCTGCAGAGGGAGCGCGAGCTGGAGTCCCA 479


15395R-2.IR_full       481 ACTTCACAAAATGCAGGCTCCTAN 503
                           ||||||||||||||||||||||| 
15395R-2.in silico     481 ACTTCACAAAATGCAGGCTCCTAG 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_134852.1  CG15395-RA (CG15395), mRNA 
0.62   NM_143303.1  CG6599-RA (CG6599), mRNA 
0   NM_130566.2  CG14781-RA (CG14781), mRNA 
0   NM_130671.2  CG2713-RA (CG2713), mRNA 
0   19  NM_001038822.1  CG31732-RG, transcript variant G (yuri), mRNA 
0   21  NM_144448.2  CG1915-RC, transcript variant C (sls), mRNA 
0   10  NM_001038820.1  CG31732-RE, transcript variant E (yuri), mRNA 
0   10  NM_001038821.1  CG31732-RF, transcript variant F (yuri), mRNA 
0   10  NM_165106.4  CG31732-RB, transcript variant B (yuri), mRNA 
0   NM_079512.2  CG2899-RA (ksr), mRNA 
0   NM_167617.1  CG32548-RB, transcript variant B (CG32548), mRNA 
0   12  NM_001014624.1  CG33555-RC, transcript variant C (btsz), mRNA 
0   NM_001014623.1  CG33555-RD, transcript variant D (btsz), mRNA 
0   NM_079937.2  CG1915-RA, transcript variant A (sls), mRNA 
0   NM_165507.1  CG12833-RA, transcript variant A (esn), mRNA 
0   NM_080251.2  CG12833-RB, transcript variant B (esn), mRNA 
0   NM_136910.1  CG13165-RA (CG13165), mRNA 
0   NM_079409.2  CG8127-RA, transcript variant A (Eip75B), mRNA 
0   10  39  NM_132457.1  CG11122-RA (CG11122), mRNA 
0   NM_134533.2  CG9578-RA (CG9578), mRNA 
0   NM_057799.3  CG2913-RA, transcript variant A (yin), mRNA 
0   14  NM_141534.1  CG7443-RA (CG7443), mRNA 
0   NM_001043010.1  CG9432-RD, transcript variant D (l(2)01289), mRNA 
0   NM_080299.2  CG18531-RA (Gr2a), mRNA 
0   NM_165734.1  CG1362-RB, transcript variant B (cdc2rk), mRNA 
0   NM_078950.2  CG1362-RA, transcript variant A (cdc2rk), mRNA 
0   NM_135859.1  CG17341-RA (CG17341), mRNA 
0   NM_142199.3  CG6156-RB, transcript variant B (CG6156), mRNA 
0   NM_169651.2  CG6156-RA, transcript variant A (CG6156), mRNA 
0   NM_206274.2  CG12605-RC, transcript variant C (CG12605), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
DM
 
VM
 
VB
 
Caspase-3 signal
N
++ 
DB
DC
++ 
DM
VM
VB
Dcompartment   Penetrance
   

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.