National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 15343R-3 
 Symbol CG15343  Full Name CG15343 
 CG No CG15343  Old CG No CG15343 
 Synonyms CG15343 
 Accession No (Link to NCBI) NM_132241.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol. (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           ||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||| silico     1   CTCTTTGGCCAAAATCGAGGACTTTCCCTCCGATC-CCGTTGAATTTTTTAAGGAGATCC 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  TTCAGGAAGCTGCCAAGGGACATCCCGATGGATTCATACAGGAAATGAACCTGGCCACCG 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 TGGACGAGGAATTCGGTGTGCTCAACCGCACTGTTCTGTACCGCGGACTCACCCAGGATA 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 ACTGTGTGTTCTACATCACCCATCGGTACGTTCGCAACTTCAAGAACCTTCAGGCCAATC 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CCAAGGCCTGCATCACCTTCTATATGCCAGATGTTAAGGATAAGGCCGGAAATCAGAATG 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CCTGGCAGGTGAGATTGATTGGAGCCACCGCCGTGGAACTTGACCAAAGCGAAATGGATG 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 CTTTGTGGGCGAAGGAGAATTTGGCTGCCCAAATCAGGGGTCACATCTGTCCCTGTGGAG 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 AACCGATTAACTACGATGATCTCAAGGCAAAGCACGATCAGTTCCTTCTGGATCACAGAG 480

15343R-3.IR_full       481 GAAAATCCATCGAGAGACCAG 501
                           ||||||||||||||||||||| silico     481 GAAAATCCATCGAGAGACCAG 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_132241.1  CG15343-RA (CG15343), mRNA 
0   NM_080365.2  CG4894-RB, transcript variant B (Ca-alpha1D), mRNA 
0   NM_165146.1  CG4894-RC, transcript variant C (Ca-alpha1D), mRNA 
0   NM_134429.2  CG4894-RA, transcript variant A (Ca-alpha1D), mRNA 
0   NM_165147.1  CG4894-RD, transcript variant D (Ca-alpha1D), mRNA 
0   NM_001014616.1  CG33512-RA (dpr4), mRNA 
0   NM_078559.2  CG18085-RA (sev), mRNA 
0   NM_057817.2  CG10637-RA, transcript variant A (Nak), mRNA 
0   NM_057818.2  CG10637-RB, transcript variant B (Nak), mRNA 
0   NM_132858.2  CG9056-RA (CG9056), mRNA 
0   NM_165201.1  CG31805-RA (CG31805), mRNA 
0   NM_080331.2  CG3578-RA (bi), mRNA 
0   NM_169872.1  CG31216-RA (CG31216), mRNA 
0   10  NM_175960.3  CG33196-RB (dp), mRNA 
0   NM_057542.2  CG6205-RA (por), mRNA 
0   NM_133060.1  CG6179-RA (CG6179), mRNA 
0   NM_137546.2  CG15105-RA, transcript variant A (CG15105), mRNA 
0   NM_166318.1  CG15105-RB, transcript variant B (CG15105), mRNA 
0   NM_139547.1  CG12077-RA (CG12077), mRNA 
0   NM_141453.2  CG1234-RA (CG1234), mRNA 
0   NM_130627.2  CG3630-RA (CG3630), mRNA 
0   NM_135497.1  CG4804-RA (CG4804), mRNA 
0   NM_078676.3  CG6223-RA (betaCop), mRNA 
0   NM_170420.1  CG18741-RA, transcript variant A (DopR2), mRNA 
0   NM_079824.2  CG18741-RB, transcript variant B (DopR2), mRNA 
0   NM_167577.1  CG15814-RB, transcript variant B (CG15814), mRNA 
0   NM_133019.2  CG15814-RA, transcript variant A (CG15814), mRNA 
0   NM_167578.1  CG15814-RC, transcript variant C (CG15814), mRNA 
0   NM_167579.1  CG15814-RD, transcript variant D (CG15814), mRNA 
0   NM_168228.1  CG32375-RA (CG32375), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.