National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 15343R-1 
 Symbol CG15343  Full Name CG15343 
 CG No CG15343  Old CG No CG15343 
 Synonyms CG15343 
 Accession No (Link to NCBI) NM_132241.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol. (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCTCTTTGGCCAAAATCGAGGA 
 Primer Seq. 3'
aatctagaggtaccCTGGTCTCTCGATGGATTTTC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CTCTTTGGCC AAAATCGAGG ACTTTCCCTC CGATCNCCGT TGAGTTTTTT AAGGAGATCC 
0061 TTCAGGAAGC TGCCAAGGGA CATCCCGATG GATTCATACA GGAAATGAAC CTGGCCACCG 
0121 TGGACGAGGA ATTCGGTGTG CTCAACCGCA CTGTTCTGTA CCGCGGACTC ACCCAGGATA 
0181 ACTGTGTGTT CTACATCACC CATCGGTACG TTCGCAACTT CAAGAACCTT CAGGCCAATC 
0241 CCAAGGCCTG CATCACCTTC TATATGCCAG ATGTTAAGGA TAAGGCCGGA AATCAGAATG 
0301 CCTGGCAGGT GAGATTGATT GGAGCCACCG CCGTGGAACT TGACCAAAGC GAAATGGATG 
0361 CTTTGTGGGC GAAGGAGAAT TTGGCTGCCC AAATCAGGGG TCACATCTGT CCCTGTGGAG 
0421 AACCGATTAA CTACGATGAT CTCAAgGCAA AGCACGATCA GTTCCTTCTG GATCACAGAG 
0481 GAAAATCCAT CGAGAGACCA G 
 in silico PCR Fragment
0001 CTCTTTGGCC AAAATCGAGG ACTTTCCCTC CGATC-CCGT TGAATTTTTT AAGGAGATCC 
0061 TTCAGGAAGC TGCCAAGGGA CATCCCGATG GATTCATACA GGAAATGAAC CTGGCCACCG 
0121 TGGACGAGGA ATTCGGTGTG CTCAACCGCA CTGTTCTGTA CCGCGGACTC ACCCAGGATA 
0181 ACTGTGTGTT CTACATCACC CATCGGTACG TTCGCAACTT CAAGAACCTT CAGGCCAATC 
0241 CCAAGGCCTG CATCACCTTC TATATGCCAG ATGTTAAGGA TAAGGCCGGA AATCAGAATG 
0301 CCTGGCAGGT GAGATTGATT GGAGCCACCG CCGTGGAACT TGACCAAAGC GAAATGGATG 
0361 CTTTGTGGGC GAAGGAGAAT TTGGCTGCCC AAATCAGGGG TCACATCTGT CCCTGTGGAG 
0421 AACCGATTAA CTACGATGAT CTCAAGGCAA AGCACGATCA GTTCCTTCTG GATCACAGAG 
0481 GAAAATCCAT CGAGAGACCA G 
 Assemble Data

15343R-1.IR_full       1   CTCTTTGGCCAAAATCGAGGACTTTCCCTCCGATCNCCGTTGAGTTTTTTAAGGAGATCC 60
                           ||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||
15343R-1.in silico     1   CTCTTTGGCCAAAATCGAGGACTTTCCCTCCGATC-CCGTTGAATTTTTTAAGGAGATCC 60


15343R-1.IR_full       61  TTCAGGAAGCTGCCAAGGGACATCCCGATGGATTCATACAGGAAATGAACCTGGCCACCG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15343R-1.in silico     61  TTCAGGAAGCTGCCAAGGGACATCCCGATGGATTCATACAGGAAATGAACCTGGCCACCG 120


15343R-1.IR_full       121 TGGACGAGGAATTCGGTGTGCTCAACCGCACTGTTCTGTACCGCGGACTCACCCAGGATA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15343R-1.in silico     121 TGGACGAGGAATTCGGTGTGCTCAACCGCACTGTTCTGTACCGCGGACTCACCCAGGATA 180


15343R-1.IR_full       181 ACTGTGTGTTCTACATCACCCATCGGTACGTTCGCAACTTCAAGAACCTTCAGGCCAATC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15343R-1.in silico     181 ACTGTGTGTTCTACATCACCCATCGGTACGTTCGCAACTTCAAGAACCTTCAGGCCAATC 240


15343R-1.IR_full       241 CCAAGGCCTGCATCACCTTCTATATGCCAGATGTTAAGGATAAGGCCGGAAATCAGAATG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15343R-1.in silico     241 CCAAGGCCTGCATCACCTTCTATATGCCAGATGTTAAGGATAAGGCCGGAAATCAGAATG 300


15343R-1.IR_full       301 CCTGGCAGGTGAGATTGATTGGAGCCACCGCCGTGGAACTTGACCAAAGCGAAATGGATG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15343R-1.in silico     301 CCTGGCAGGTGAGATTGATTGGAGCCACCGCCGTGGAACTTGACCAAAGCGAAATGGATG 360


15343R-1.IR_full       361 CTTTGTGGGCGAAGGAGAATTTGGCTGCCCAAATCAGGGGTCACATCTGTCCCTGTGGAG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15343R-1.in silico     361 CTTTGTGGGCGAAGGAGAATTTGGCTGCCCAAATCAGGGGTCACATCTGTCCCTGTGGAG 420


15343R-1.IR_full       421 AACCGATTAACTACGATGATCTCAAGGCAAAGCACGATCAGTTCCTTCTGGATCACAGAG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15343R-1.in silico     421 AACCGATTAACTACGATGATCTCAAGGCAAAGCACGATCAGTTCCTTCTGGATCACAGAG 480


15343R-1.IR_full       481 GAAAATCCATCGAGAGACCAG 501
                           |||||||||||||||||||||
15343R-1.in silico     481 GAAAATCCATCGAGAGACCAG 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_132241.1  CG15343-RA (CG15343), mRNA 
0   NM_080365.2  CG4894-RB, transcript variant B (Ca-alpha1D), mRNA 
0   NM_165146.1  CG4894-RC, transcript variant C (Ca-alpha1D), mRNA 
0   NM_134429.2  CG4894-RA, transcript variant A (Ca-alpha1D), mRNA 
0   NM_165147.1  CG4894-RD, transcript variant D (Ca-alpha1D), mRNA 
0   NM_001014616.1  CG33512-RA (dpr4), mRNA 
0   NM_078559.2  CG18085-RA (sev), mRNA 
0   NM_057817.2  CG10637-RA, transcript variant A (Nak), mRNA 
0   NM_057818.2  CG10637-RB, transcript variant B (Nak), mRNA 
0   NM_132858.2  CG9056-RA (CG9056), mRNA 
0   NM_165201.1  CG31805-RA (CG31805), mRNA 
0   NM_080331.2  CG3578-RA (bi), mRNA 
0   NM_169872.1  CG31216-RA (CG31216), mRNA 
0   10  NM_175960.3  CG33196-RB (dp), mRNA 
0   NM_057542.2  CG6205-RA (por), mRNA 
0   NM_133060.1  CG6179-RA (CG6179), mRNA 
0   NM_137546.2  CG15105-RA, transcript variant A (CG15105), mRNA 
0   NM_166318.1  CG15105-RB, transcript variant B (CG15105), mRNA 
0   NM_139547.1  CG12077-RA (CG12077), mRNA 
0   NM_141453.2  CG1234-RA (CG1234), mRNA 
0   NM_130627.2  CG3630-RA (CG3630), mRNA 
0   NM_135497.1  CG4804-RA (CG4804), mRNA 
0   NM_078676.3  CG6223-RA (betaCop), mRNA 
0   NM_170420.1  CG18741-RA, transcript variant A (DopR2), mRNA 
0   NM_079824.2  CG18741-RB, transcript variant B (DopR2), mRNA 
0   NM_167577.1  CG15814-RB, transcript variant B (CG15814), mRNA 
0   NM_133019.2  CG15814-RA, transcript variant A (CG15814), mRNA 
0   NM_167578.1  CG15814-RC, transcript variant C (CG15814), mRNA 
0   NM_167579.1  CG15814-RD, transcript variant D (CG15814), mRNA 
0   NM_168228.1  CG32375-RA (CG32375), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
++ 
DM
 
VM
 
VB
 
Caspase-3 signal
N
DB
DC
++ 
DM
 
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.