National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 15255R-2 
 Symbol CG15255  Full Name CG15255 
 CG No CG15255  Old CG No CG15255 
 Synonyms BG:BACR44L22.1, CG15255 
 Accession No (Link to NCBI) NM_135911.1 
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAGGTGGATTTGTCGAGGGTGA 
 Primer Seq. 3'
aatctagaggtaccCTGTGTCGGCATACTTTTGGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AGGTGGATTT GTCGAGGGTG ATATGATGCT AACGGAGGAG CAACAAAGAA ATCTGGAGCA 
0061 GGGTGCTCCC AAGGCTCGCA ATGGCCTTAT CAACACGGAA AAGAGATGGC CTGGAAATGT 
0121 GGTGGTCTAC AGGATATCAG ATGACTTTGA CACGGCGCAC AAGAAGGCCA TCCAAACTGG 
0181 CATCGATACC TTGGAGCTGC ACACTTGTTT GAGGTTTAGG GAAGCCACCG ATGAGGATAA 
0241 GGCCTATTTG ACGGTTACGG CCAAGTCTGG AGGATGCTAC ACTGCCGTCG GCTACCAAGG 
0301 TGCCCCGCAG GAAATGAATC TGGAAATATA CCCGCTCGGC GAAGGCTGTT TCCGGCCCGG 
0361 AACGATCCTG CATGAGTTTA TGCACGCCTT GGGATTCTAT CACCAACAGA GCTCGTCCAT 
0421 TCGAGATGAT TTTATAAACG TGATCTACGA AAACATAGTG CCGGGCAAGG AATTCAATTT 
0481 CCAAAAGTAT GCCGACACAG  
 in silico PCR Fragment
0001 AGGTGGATTT GTCGAGGGTG ATATGATGCT AACGGAGGAG CAACAAAGAA ATCTGGAGCA 
0061 GGGTGCTCCC AAGGCTCGCA ATGGCCTTAT CAACACGGAA AAGAGATGGC CTGGAAATGT 
0121 GGTGGTCTAC AGGATATCAG ATGACTTTGA CACGGCGCAC AAGAAGGCCA TCCAAACTGG 
0181 CATCGATACC TTGGAGCTGC ACACTTGTTT GAGGTTTAGG GAAGCCACCG ATGAGGATAA 
0241 GGCCTATTTG ACGGTTACGG CCAAGTCTGG AGGATGCTAC ACTGCCGTCG GCTACCAAGG 
0301 TGCCCCGCAG GAAATGAATC TGGAAATATA CCCGCTCGGC GAAGGCTGTT TCCGGCCCGG 
0361 AACGATCCTG CATGAGTTTA TGCACGCCTT GGGATTCTAT CACCAACAGA GCTCGTCCAT 
0421 TCGAGATGAT TTTATAAACG TGATCTACGA AAACATAGTG CCGGGCAAGG AATTCAATTT 
0481 CCAAAAGTAT GCCGACACAG  
 Assemble Data

15255R-2.IR_full       1   AGGTGGATTTGTCGAGGGTGATATGATGCTAACGGAGGAGCAACAAAGAAATCTGGAGCA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15255R-2.in silico     1   AGGTGGATTTGTCGAGGGTGATATGATGCTAACGGAGGAGCAACAAAGAAATCTGGAGCA 60


15255R-2.IR_full       61  GGGTGCTCCCAAGGCTCGCAATGGCCTTATCAACACGGAAAAGAGATGGCCTGGAAATGT 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15255R-2.in silico     61  GGGTGCTCCCAAGGCTCGCAATGGCCTTATCAACACGGAAAAGAGATGGCCTGGAAATGT 120


15255R-2.IR_full       121 GGTGGTCTACAGGATATCAGATGACTTTGACACGGCGCACAAGAAGGCCATCCAAACTGG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15255R-2.in silico     121 GGTGGTCTACAGGATATCAGATGACTTTGACACGGCGCACAAGAAGGCCATCCAAACTGG 180


15255R-2.IR_full       181 CATCGATACCTTGGAGCTGCACACTTGTTTGAGGTTTAGGGAAGCCACCGATGAGGATAA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15255R-2.in silico     181 CATCGATACCTTGGAGCTGCACACTTGTTTGAGGTTTAGGGAAGCCACCGATGAGGATAA 240


15255R-2.IR_full       241 GGCCTATTTGACGGTTACGGCCAAGTCTGGAGGATGCTACACTGCCGTCGGCTACCAAGG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15255R-2.in silico     241 GGCCTATTTGACGGTTACGGCCAAGTCTGGAGGATGCTACACTGCCGTCGGCTACCAAGG 300


15255R-2.IR_full       301 TGCCCCGCAGGAAATGAATCTGGAAATATACCCGCTCGGCGAAGGCTGTTTCCGGCCCGG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15255R-2.in silico     301 TGCCCCGCAGGAAATGAATCTGGAAATATACCCGCTCGGCGAAGGCTGTTTCCGGCCCGG 360


15255R-2.IR_full       361 AACGATCCTGCATGAGTTTATGCACGCCTTGGGATTCTATCACCAACAGAGCTCGTCCAT 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15255R-2.in silico     361 AACGATCCTGCATGAGTTTATGCACGCCTTGGGATTCTATCACCAACAGAGCTCGTCCAT 420


15255R-2.IR_full       421 TCGAGATGATTTTATAAACGTGATCTACGAAAACATAGTGCCGGGCAAGGAATTCAATTT 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15255R-2.in silico     421 TCGAGATGATTTTATAAACGTGATCTACGAAAACATAGTGCCGGGCAAGGAATTCAATTT 480


15255R-2.IR_full       481 CCAAAAGTATGCCGACACAG 500
                           ||||||||||||||||||||
15255R-2.in silico     481 CCAAAAGTATGCCGACACAG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_135911.1  CG15255-RA (CG15255), mRNA 
0.2   NM_135191.2  CG9537-RA (DLP), mRNA 
0   NM_134671.1  CG11592-RA (CG11592), mRNA 
0   NM_135691.1  CG6734-RA (CG6734), mRNA 
0   NM_001014500.1  CG33558-RA (CG33558), mRNA 
0   NM_167704.1  CG11710-RA, transcript variant A (CG11710), mRNA 
0   NM_134549.2  CG11710-RB, transcript variant B (CG11710), mRNA 
0   NM_078697.2  CG1668-RA, transcript variant A (Pbprp2), mRNA 
0   NM_176767.1  CG1668-RB, transcript variant B (Pbprp2), mRNA 
0   NM_057675.3  CG8169-RA (Pms2), mRNA 
0   NM_134281.1  CG8651-RC, transcript variant C (trx), mRNA 
0   NM_057421.2  CG8651-RD, transcript variant D (trx), mRNA 
0   NM_057422.2  CG8651-RB, transcript variant B (trx), mRNA 
0   NM_001014621.1  CG8651-RE, transcript variant E (trx), mRNA 
0   NM_134282.1  CG8651-RA, transcript variant A (trx), mRNA 
0   NM_165226.1  CG7100-RF, transcript variant F (CadN), mRNA 
0   NM_165227.1  CG7100-RD, transcript variant D (CadN), mRNA 
0   NM_165228.1  CG7100-RC, transcript variant C (CadN), mRNA 
0   NM_165229.1  CG7100-RA, transcript variant A (CadN), mRNA 
0   NM_165230.1  CG7100-RG, transcript variant G (CadN), mRNA 
0   NM_165231.1  CG7100-RE, transcript variant E (CadN), mRNA 
0   NM_001032108.1  CG7100-RJ, transcript variant J (CadN), mRNA 
0   NM_001032109.1  CG7100-RI, transcript variant I (CadN), mRNA 
0   NM_001032107.1  CG7100-RK, transcript variant K (CadN), mRNA 
0   NM_001032106.1  CG7100-RL, transcript variant L (CadN), mRNA 
0   NM_165225.1  CG7100-RB, transcript variant B (CadN), mRNA 
0   NM_165224.1  CG7100-RH, transcript variant H (CadN), mRNA 
0   NM_142483.2  CG7702-RA, transcript variant A (CG7702), mRNA 
0   NM_169829.1  CG7702-RB, transcript variant B (CG7702), mRNA 
0   NM_139511.2  CG1869-RA (CG1869), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.