National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 15254R-3 
 Symbol CG15254  Full Name CG15254 
 CG No CG15254  Old CG No CG15254 
 Synonyms BACcr44L22.2, BG:BACR44L22.2, CG15254 
 Accession No (Link to NCBI) NM_135913.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACCTGGGCCTTAACTTTAGTG 
 Primer Seq. 3'
aatctagaggtaccCGGACATAGTCATCGCGATTC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ACCTGGGCCT TAACTTTAGT GGTCATATTC TTGGCCAGCT CCTGCTCGGC AGCTCCCACC 
0061 ACACAGAACA GGATAGAAAC CGATCCTGAA CTGACAGCTG GCTATATTGA AGGCGACATG 
0121 GTGCCCAGTC CGGAGGGAAG GAACGGACTT CGCAATGAAA CCTTCAGATG GCCAAACCGC 
0181 ATTGTCTATT ATTACATCAA TCGCGATATT GACACCGAGC ATCGCAACCA TATTCTAAGA 
0241 GGTATTCGCA TAATAGAACA AAGTTCTTGC TTGGTCTTCA AGGAGGCCAC CACTGATCAG 
0301 GAATATTATG TGAATGTTAC CTCGGAGGCT GGAGGATGTT ACTCGTATGT TGGCTATCGC 
0361 AACCGGGTTC AGCAGCTGAA TCTGCAGACC TACGCTCTGG ACACCGGCTG CTTCCGTCTG 
0421 GGAACAATTG TCCACGAGTT CCTGCCATGC CCTTGGCTTC TATCACCAGC AAAGCACCTG 
0481 GAATCGCGAT GACTATGTCC NGG 
 in silico PCR Fragment
0001 ACCTGGGCCT TAACTTTAGT GGTCATATTC TTGGCCAGCT CCTGCTCGGC AGCTCCCACC 
0061 ACACAGAACA GGATAGAAAC CGATCCTGAA CTGACAGCTG GCTATATTGA AGGCGACATG 
0121 GTGCCCAGTC CGGAGGGAAG GAACGGACTT CGCAATGAAA CCTTCAGATG GCCAAACCGC 
0181 ATTGTCTATT ATTACATCAA TCGCGATATT GACACCGAGC ATCGCAACCA TATTCTAAGA 
0241 GGTATTCGCA TAATAGAACA AAGTTCTTGC TTGGTCTTCA AGGAGGCCAC CACTGATCAG 
0301 GAATATTATG TGAATGTTAC CTCGGAGGCT GGAGGATGTT ACTCGTATGT TGGCTATCGC 
0361 AACCGGGTTC AGCAGCTGAA TCTGCAGACC TACGCTCTGG ACACCGGCTG CTTCCGTCTG 
0421 GGAACAATTG TCCACGAGTT CCTG-CATGC CCTTGGCTTC TATCACCAGC AAAGCACCTG 
0481 GAATCGCGAT GACTATGTCC --G 
 Assemble Data

15254R-3.IR_full       1   ACCTGGGCCTTAACTTTAGTGGTCATATTCTTGGCCAGCTCCTGCTCGGCAGCTCCCACC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15254R-3.in silico     1   ACCTGGGCCTTAACTTTAGTGGTCATATTCTTGGCCAGCTCCTGCTCGGCAGCTCCCACC 60


15254R-3.IR_full       61  ACACAGAACAGGATAGAAACCGATCCTGAACTGACAGCTGGCTATATTGAAGGCGACATG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15254R-3.in silico     61  ACACAGAACAGGATAGAAACCGATCCTGAACTGACAGCTGGCTATATTGAAGGCGACATG 120


15254R-3.IR_full       121 GTGCCCAGTCCGGAGGGAAGGAACGGACTTCGCAATGAAACCTTCAGATGGCCAAACCGC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15254R-3.in silico     121 GTGCCCAGTCCGGAGGGAAGGAACGGACTTCGCAATGAAACCTTCAGATGGCCAAACCGC 180


15254R-3.IR_full       181 ATTGTCTATTATTACATCAATCGCGATATTGACACCGAGCATCGCAACCATATTCTAAGA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15254R-3.in silico     181 ATTGTCTATTATTACATCAATCGCGATATTGACACCGAGCATCGCAACCATATTCTAAGA 240


15254R-3.IR_full       241 GGTATTCGCATAATAGAACAAAGTTCTTGCTTGGTCTTCAAGGAGGCCACCACTGATCAG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15254R-3.in silico     241 GGTATTCGCATAATAGAACAAAGTTCTTGCTTGGTCTTCAAGGAGGCCACCACTGATCAG 300


15254R-3.IR_full       301 GAATATTATGTGAATGTTACCTCGGAGGCTGGAGGATGTTACTCGTATGTTGGCTATCGC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15254R-3.in silico     301 GAATATTATGTGAATGTTACCTCGGAGGCTGGAGGATGTTACTCGTATGTTGGCTATCGC 360


15254R-3.IR_full       361 AACCGGGTTCAGCAGCTGAATCTGCAGACCTACGCTCTGGACACCGGCTGCTTCCGTCTG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15254R-3.in silico     361 AACCGGGTTCAGCAGCTGAATCTGCAGACCTACGCTCTGGACACCGGCTGCTTCCGTCTG 420


15254R-3.IR_full       421 GGAACAATTGTCCACGAGTTCCTGCCATGCCCTTGGCTTCTATCACCAGCAAAGCACCTG 480
                           |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
15254R-3.in silico     421 GGAACAATTGTCCACGAGTTCCTG-CATGCCCTTGGCTTCTATCACCAGCAAAGCACCTG 480


15254R-3.IR_full       481 GAATCGCGATGACTATGTCCNGG 503
                           ||||||||||||||||||||  |
15254R-3.in silico     481 GAATCGCGATGACTATGTCC--G 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_135913.2  CG15254-RA (CG15254), mRNA 
0.41   18  36  58  NM_135914.1  CG15253-RA (CG15253), mRNA 
0   NM_134997.2  CG17840-RA (CG17840), mRNA 
0   NM_079119.2  CG4354-RA (slbo), mRNA 
0   NM_078514.2  CG9653-RA (brk), mRNA 
0   NM_142495.1  CG14299-RA, transcript variant A (CG14299), mRNA 
0   NM_001014640.1  CG14299-RB, transcript variant B (CG14299), mRNA 
0   NM_141696.1  CG8526-RA (CG8526), mRNA 
0   NM_134764.2  CG31935-RA (CG31935), mRNA 
0   NM_132073.1  CG14445-RA (CG14445), mRNA 
0   NM_165325.1  CG10076-RC, transcript variant C (spir), mRNA 
0   NM_165324.1  CG10076-RD, transcript variant D (spir), mRNA 
0   NM_080115.2  CG10076-RB, transcript variant B (spir), mRNA 
0   NM_165323.1  CG10076-RA, transcript variant A (spir), mRNA 
0   NM_080342.2  CG1787-RA (Hexo2), mRNA 
0   NM_141113.2  CG7442-RA (CG7442), mRNA 
0   NM_141244.2  CG14657-RB (CG14657), mRNA 
0   NM_142092.2  CG14840-RA (CG14840), mRNA 
0   NM_206691.2  CG1817-RA, transcript variant A (Ptp10D), mRNA 
0   NM_206690.1  CG1817-RD, transcript variant D (Ptp10D), mRNA 
0   NM_167292.2  CG1817-RB, transcript variant B (Ptp10D), mRNA 
0   NM_144448.2  CG1915-RC, transcript variant C (sls), mRNA 
0   NM_141464.1  CG10113-RA (wa-cup), mRNA 
0   NM_134642.2  CG11371-RB (dbr), mRNA 
0   NM_143092.2  CG10244-RA (Cad96Ca), mRNA 
0   NM_079937.2  CG1915-RA, transcript variant A (sls), mRNA 
0   NM_168607.1  CG6854-RA, transcript variant A (CG6854), mRNA 
0   NM_079263.2  CG5263-RA, transcript variant A (smg), mRNA 
0   NM_133090.1  CG6696-RA (CG6696), mRNA 
0   NM_169609.1  CG31304-RA (CG31304), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.