National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 15253R-4 
 Symbol CG15253  Full Name CG15253 
 CG No CG15253  Old CG No CG15253 
 Synonyms BACR44L22.3, BG:BACR44L22.3, CG15253 
 Accession No (Link to NCBI) NM_135914.1 
 Inserted Chr.
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGAGGGTGATATGGTGCCCAGT 
 Primer Seq. 3'
aatctagaggtaccTGCATTACGCTGCCATAGTCG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GAGGGTAGAT ATGGTGCCCA GTGGATCCTC GAGAAATATT TGGCGCAACG AAACCTATAG 
0061 ATGGCCCAAT CGCATTATTT ATTACCATAT TAATAGCTAT ATTGATGAAG AACATCGTAA 
0121 CCACATCGTG AGCGCTATTC AGAAAATCGA ATCCATTTCA TGCCTGACCT TCAAAGAGGC 
0181 CACCACTGAT CAGAAGTATT ATGTAAATGT GACCTCCGAG GAGGGCGGCT GTTTCTCCTA 
0241 CATCGGTTAT CTGAATCGCG TTCAACAACT GAATCTCCAG AATAATGAAA TAGGCGTCGG 
0301 TTGTTTCCGT TTGTATACGA TAGTGCATGA GTTCCTGCAT GCCCTTGGAT TTTTCCATCA 
0361 GCAAAGTGCC GCCGATCGGG ATGATTATGT CCAAATTGTG GAGGAGAATA TCACCGAAGG 
0421 CATGGAGTTT AACTTTGATA AATATACCGA GGAAACCGTC AATGATTTTG GTGAGAAATA 
0481 CGACTATGGC AGCGTAATGC A 
 in silico PCR Fragment
0001 GAGGGT-GAT ATGGTGCCCA GTGGATCCTC GAGAAATATT TGGCGCAACG AAACCTATAG 
0061 ATGGCCCAAT CGCATTATTT ATTACCATAT TAATAGCTAT ATTGATGAAG AACATCGTAA 
0121 CCACATCGTG AGCGCTATTC AGAAAATCGA ATCCATTTCA TGCCTGACCT TCAAAGAGGC 
0181 CACCACTGAT CAGAAGTATT ATGTAAATGT GACCTCCGAG GAGGGCGGTT GTTTCTCCTA 
0241 CATCGGTTAT CTGAATCGCG TTCAACAACT GAATCTCCAG AATAATGAAA TAGGCGTCGG 
0301 TTGTTTCCGT TTGTATACGA TAGTGCATGA GTTCCTGCAT GCCCTTGGAT TTTTCCATCA 
0361 GCAAAGTGCC GCCGATCGGG ATGATTATGT CCAAATTGTG GAGGAGAATA TCACCGAAGG 
0421 CATGGAGTTT AACTTTGATA AATATACCGA GGAAACCGTC AATGATTTTG GTGAGAAATA 
0481 CGACTATGGC AGCGTAATGC A 
 Assemble Data

15253R-4.IR_full       1   GAGGGTAGATATGGTGCCCAGTGGATCCTCGAGAAATATTTGGCGCAACGAAACCTATAG 60
                           |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
15253R-4.in silico     1   GAGGGT-GATATGGTGCCCAGTGGATCCTCGAGAAATATTTGGCGCAACGAAACCTATAG 60


15253R-4.IR_full       61  ATGGCCCAATCGCATTATTTATTACCATATTAATAGCTATATTGATGAAGAACATCGTAA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15253R-4.in silico     61  ATGGCCCAATCGCATTATTTATTACCATATTAATAGCTATATTGATGAAGAACATCGTAA 120


15253R-4.IR_full       121 CCACATCGTGAGCGCTATTCAGAAAATCGAATCCATTTCATGCCTGACCTTCAAAGAGGC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15253R-4.in silico     121 CCACATCGTGAGCGCTATTCAGAAAATCGAATCCATTTCATGCCTGACCTTCAAAGAGGC 180


15253R-4.IR_full       181 CACCACTGATCAGAAGTATTATGTAAATGTGACCTCCGAGGAGGGCGGCTGTTTCTCCTA 240
                           |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
15253R-4.in silico     181 CACCACTGATCAGAAGTATTATGTAAATGTGACCTCCGAGGAGGGCGGTTGTTTCTCCTA 240


15253R-4.IR_full       241 CATCGGTTATCTGAATCGCGTTCAACAACTGAATCTCCAGAATAATGAAATAGGCGTCGG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15253R-4.in silico     241 CATCGGTTATCTGAATCGCGTTCAACAACTGAATCTCCAGAATAATGAAATAGGCGTCGG 300


15253R-4.IR_full       301 TTGTTTCCGTTTGTATACGATAGTGCATGAGTTCCTGCATGCCCTTGGATTTTTCCATCA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15253R-4.in silico     301 TTGTTTCCGTTTGTATACGATAGTGCATGAGTTCCTGCATGCCCTTGGATTTTTCCATCA 360


15253R-4.IR_full       361 GCAAAGTGCCGCCGATCGGGATGATTATGTCCAAATTGTGGAGGAGAATATCACCGAAGG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15253R-4.in silico     361 GCAAAGTGCCGCCGATCGGGATGATTATGTCCAAATTGTGGAGGAGAATATCACCGAAGG 420


15253R-4.IR_full       421 CATGGAGTTTAACTTTGATAAATATACCGAGGAAACCGTCAATGATTTTGGTGAGAAATA 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15253R-4.in silico     421 CATGGAGTTTAACTTTGATAAATATACCGAGGAAACCGTCAATGATTTTGGTGAGAAATA 480


15253R-4.IR_full       481 CGACTATGGCAGCGTAATGCA 501
                           |||||||||||||||||||||
15253R-4.in silico     481 CGACTATGGCAGCGTAATGCA 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_135914.1  CG15253-RA (CG15253), mRNA 
0.41   15  18  49  NM_135913.2  CG15254-RA (CG15254), mRNA 
0   NM_142881.2  CG6763-RA (CG6763), mRNA 
0   NM_079876.2  CG1483-RA, transcript variant A (Map205), mRNA 
0   NM_170586.1  CG1483-RB, transcript variant B (Map205), mRNA 
0   10  NM_142985.1  CG5715-RA (CG5715), mRNA 
0   NM_137095.2  CG8415-RA (RpS23), mRNA 
0   NM_142083.2  CG14355-RA (CG14355), mRNA 
0   NM_079132.2  CG16910-RA (key), mRNA 
0   NM_138124.2  CG3589-RA (CG3589), mRNA 
0   NM_137497.2  CG10924-RA (CG10924), mRNA 
0   NM_141894.2  CG14739-RA (CG14739), mRNA 
0   NM_137232.3  CG8389-RB, transcript variant B (CG8389), mRNA 
0   NM_166132.2  CG8389-RA, transcript variant A (CG8389), mRNA 
0   NM_168346.1  CG32043-RB, transcript variant B (CG32043), mRNA 
0   NM_140064.2  CG32043-RA, transcript variant A (CG32043), mRNA 
0   NM_139758.1  CG10475-RA (Jon65Ai), mRNA 
0   NM_078517.2  CG2175-RA, transcript variant A (dec-1), mRNA 
0   NM_167133.1  CG2175-RC, transcript variant C (dec-1), mRNA 
0   NM_167132.1  CG2175-RB, transcript variant B (dec-1), mRNA 
0   NM_143065.2  CG6422-RA, transcript variant A (CG6422), mRNA 
0   NM_170188.1  CG6422-RB, transcript variant B (CG6422), mRNA 
0   NM_057949.3  CG10270-RA (D19B), mRNA 
0   NM_135344.2  CG8486-RA, transcript variant A (CG8486), mRNA 
0   NM_164795.2  CG8486-RB, transcript variant B (CG8486), mRNA 
0   NM_001042881.1  CG8486-RC, transcript variant C (CG8486), mRNA 
0   NM_164517.1  CG8817-RC, transcript variant C (lilli), mRNA 
0   NM_164516.1  CG8817-RA, transcript variant A (lilli), mRNA 
0   NM_078741.2  CG8825-RA (gkt), mRNA 
0   NM_142098.1  CG8538-RA (CG8538), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.