National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 15253R-1 
 Symbol CG15253  Full Name CG15253 
 CG No CG15253  Old CG No CG15253 
 Synonyms BACR44L22.3, BG:BACR44L22.3, CG15253 
 Accession No (Link to NCBI) NM_135914.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   GAGGGT-GATATGGTGCCCAGTGGATCCTCGAGAAATATTTGGCGCAACGAAACCTATAG 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  ATGGCCCAATCGCATTATTTATTACCATATTAATAGCTATATTGATGAAGAACATCGTAA 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CCACATCGTGAGCGCTATTCAGAAAATCGAATCCATTTCATGCCTGACCTTCAAAGAGGC 180

                           |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| silico     181 CACCACTGATCAGAAGTATTATGTAAATGTGACCTCCGAGGAGGGCGGTTGTTTCTCCTA 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CATCGGTTATCTGAATCGCGTTCAACAACTGAATCTCCAGAATAATGAAATAGGCGTCGG 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 TTGTTTCCGTTTGTATACGATAGTGCATGAGTTCCTGCATGCCCTTGGATTTTTCCATCA 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GCAAAGTGCCGCCGATCGGGATGATTATGTCCAAATTGTGGAGGAGAATATCACCGAAGG 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 CATGGAGTTTAACTTTGATAAATATACCGAGGAAACCGTCAATGATTTTGGTGAGAAATA 480

15253R-1.IR_full       481 CGACTATGGCAGCGTAATGCA 501
                           ||||||||||||||||||||| silico     481 CGACTATGGCAGCGTAATGCA 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_135914.1  CG15253-RA (CG15253), mRNA 
0.41   15  18  49  NM_135913.2  CG15254-RA (CG15254), mRNA 
0   NM_142881.2  CG6763-RA (CG6763), mRNA 
0   NM_079876.2  CG1483-RA, transcript variant A (Map205), mRNA 
0   NM_170586.1  CG1483-RB, transcript variant B (Map205), mRNA 
0   10  NM_142985.1  CG5715-RA (CG5715), mRNA 
0   NM_137095.2  CG8415-RA (RpS23), mRNA 
0   NM_142083.2  CG14355-RA (CG14355), mRNA 
0   NM_079132.2  CG16910-RA (key), mRNA 
0   NM_138124.2  CG3589-RA (CG3589), mRNA 
0   NM_137497.2  CG10924-RA (CG10924), mRNA 
0   NM_141894.2  CG14739-RA (CG14739), mRNA 
0   NM_137232.3  CG8389-RB, transcript variant B (CG8389), mRNA 
0   NM_166132.2  CG8389-RA, transcript variant A (CG8389), mRNA 
0   NM_168346.1  CG32043-RB, transcript variant B (CG32043), mRNA 
0   NM_140064.2  CG32043-RA, transcript variant A (CG32043), mRNA 
0   NM_139758.1  CG10475-RA (Jon65Ai), mRNA 
0   NM_078517.2  CG2175-RA, transcript variant A (dec-1), mRNA 
0   NM_167133.1  CG2175-RC, transcript variant C (dec-1), mRNA 
0   NM_167132.1  CG2175-RB, transcript variant B (dec-1), mRNA 
0   NM_143065.2  CG6422-RA, transcript variant A (CG6422), mRNA 
0   NM_170188.1  CG6422-RB, transcript variant B (CG6422), mRNA 
0   NM_057949.3  CG10270-RA (D19B), mRNA 
0   NM_135344.2  CG8486-RA, transcript variant A (CG8486), mRNA 
0   NM_164795.2  CG8486-RB, transcript variant B (CG8486), mRNA 
0   NM_001042881.1  CG8486-RC, transcript variant C (CG8486), mRNA 
0   NM_164517.1  CG8817-RC, transcript variant C (lilli), mRNA 
0   NM_164516.1  CG8817-RA, transcript variant A (lilli), mRNA 
0   NM_078741.2  CG8825-RA (gkt), mRNA 
0   NM_142098.1  CG8538-RA (CG8538), mRNA 
 Wing Disc
JNK signal
Caspase-3 signal
Dcompartment   Penetrance

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.