National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1524R-3 
 Symbol RpS14a  Full Name Ribosomal protein S14a 
 CG No CG1524  Old CG No CG1524 
 Synonyms S14, RpS14A, RpS14, RPS14A, rpS14A, anon-EST:Posey77, anon-EST:Posey154, anon-EST:Posey131, anon-EST:Posey115, CG1524, anon-WO03040301.138, anon-WO03040301.136, RpS14a 
 Accession No (Link to NCBI) NM_167137.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   TGGCACCCAGGAAGGCTAAAGTTCAGAAGGAGGAGGTTCAGGTCCAGCTGGGACCCCAAG 60

                          |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| silico     61  TTCGCGACGGCGAG-ATCGTGTTCGGAGTGGCTCACATCTACGCCAGCTTCAACGACACC 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 TTCGTCCATGTCACTGATCTGTCCGGCCGTGAGACCATCGCTCGTGTCACCGGAGGCATG 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 AAGGTGAAGGCCGATCGTGATGAGGCTTCGCCCTACGCCGCTATGTTGGCCGCTCAGGAT 240

                          ||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||| silico     241 GTGGCTGAGAAGTGCAAGACA-CTGGGCATTACTGCCCTGCATATTAAGCTGCGTGCCAC 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CGGCGGCAACAAGACCAAGACCCCCGGACCCGGCGCCCAGTCCGCTCTGCGTGCTTTGGC 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 CCGTTCGTCCATGAAGATTGGCCGCATCGAGGATGTGACGCCCATCCCATCGGACT 416

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   396  NM_080145.4  CG1524-RB, transcript variant B (RpS14a), mRNA 
100   396  NM_167137.1  CG1524-RA, transcript variant A (RpS14a), mRNA 
78.53   311  63  17  NM_080427.2  CG1527-RA (RpS14b), mRNA 
0   NM_140688.2  CG7728-RA (CG7728), mRNA 
0   NM_165249.1  CG5803-RB, transcript variant B (Fas3), mRNA 
0   NM_165250.1  CG5803-RA, transcript variant A (Fas3), mRNA 
0   NM_169291.1  CG9381-RB, transcript variant B (mura), mRNA 
0   NM_169292.2  CG9381-RC, transcript variant C (mura), mRNA 
0   NM_141645.2  CG9381-RA, transcript variant A (mura), mRNA 
0   NM_176100.1  CG30492-RC, transcript variant C (CG30492), mRNA 
0   NM_176101.1  CG30492-RE, transcript variant E (CG30492), mRNA 
0   NM_170613.2  CG30492-RA, transcript variant A (CG30492), mRNA 
0   NM_170614.2  CG30492-RB, transcript variant B (CG30492), mRNA 
0   NM_137384.2  CG4878-RB, transcript variant B (eIF3-S9), mRNA 
0   NM_166239.2  CG4878-RA, transcript variant A (eIF3-S9), mRNA 
0   NM_169654.2  CG31302-RC, transcript variant C (CG31302), mRNA 
0   NM_169652.2  CG31302-RA, transcript variant A (CG31302), mRNA 
0   NM_169653.2  CG31302-RB, transcript variant B (CG31302), mRNA 
0   NM_001031986.1  CG33719-RB, transcript variant B (Pif1A), mRNA 
0   NM_080338.3  CG6824-RA, transcript variant A (ovo), mRNA 
0   NM_001038742.1  CG6824-RD, transcript variant D (ovo), mRNA 
0   NM_167027.2  CG6824-RC, transcript variant C (ovo), mRNA 
0   NM_167026.2  CG6824-RB, transcript variant B (ovo), mRNA 
0   NM_001042810.1  CG10952-RB, transcript variant B (eag), mRNA 
0   NM_078603.2  CG10952-RA, transcript variant A (eag), mRNA 
0   NM_136878.2  CG8364-RB, transcript variant B (Rep3), mRNA 
0   NM_136879.2  CG8364-RA, transcript variant A (Rep3), mRNA 
0   16  60  NM_166125.2  CG18255-RA, transcript variant A (Strn-Mlck), mRNA 
0   16  60  NM_166129.2  CG18255-RD, transcript variant D (Strn-Mlck), mRNA 
0   NM_168738.1  CG32184-RA (CG32184), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.