National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1524R-2 
 Symbol RpS14a  Full Name Ribosomal protein S14a 
 CG No CG1524  Old CG No CG1524 
 Synonyms S14, RpS14A, RpS14, RPS14A, rpS14A, anon-EST:Posey77, anon-EST:Posey154, anon-EST:Posey131, anon-EST:Posey115, CG1524, anon-WO03040301.138, anon-WO03040301.136, RpS14a 
 Accession No (Link to NCBI) NM_167137.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGGCACCCAGGAAGGCTAAAG 
 Primer Seq. 3'
aatctagaggtaccAGTCCGATGGGATGGGCGTCA 
 Predicted Fragment Size
414 
 IR fragment full Seq
0001 TGGCACCCAG GAAGGCTAAA GTTCAGAAGG AGGAGGTTCA GGTCCAGCTG GGACCCCAAG 
0061 TTCGCGACGG CGAGNATCGT GTTCGGAGTG GCTCACATCT ACGCCAGCTT CAACGACACC 
0121 TTCGTCCATG TCACTGATCT GTCCGGCCGT GAGACCATCG CTCGTGTCAC CGGAGGCATG 
0181 AAGGTGAAGG CCGATCGTGA TGAGGCTTCG CCCTACGCCG CTATGTTGGC CGCTCAGGAT 
0241 GTGGCTGAGA AGTGCAAGAC ANCTGGGCAT CACTGCCCTG CATATTAAGC TGCGTGCCAC 
0301 CGGCGGCAAC AAGACCAAGA CCCCCGGACC CGGCGCCCAG TCCGCTCTGC GTGCTTTGGC 
0361 CCGTTCGTCC ATGAAGATTG GCCGCATCGA GGATGTGACG CCCATCCCAT CGGACT 
 in silico PCR Fragment
0001 TGGCACCCAG GAAGGCTAAA GTTCAGAAGG AGGAGGTTCA GGTCCAGCTG GGACCCCAAG 
0061 TTCGCGACGG CGAG-ATCGT GTTCGGAGTG GCTCACATCT ACGCCAGCTT CAACGACACC 
0121 TTCGTCCATG TCACTGATCT GTCCGGCCGT GAGACCATCG CTCGTGTCAC CGGAGGCATG 
0181 AAGGTGAAGG CCGATCGTGA TGAGGCTTCG CCCTACGCCG CTATGTTGGC CGCTCAGGAT 
0241 GTGGCTGAGA AGTGCAAGAC A-CTGGGCAT TACTGCCCTG CATATTAAGC TGCGTGCCAC 
0301 CGGCGGCAAC AAGACCAAGA CCCCCGGACC CGGCGCCCAG TCCGCTCTGC GTGCTTTGGC 
0361 CCGTTCGTCC ATGAAGATTG GCCGCATCGA GGATGTGACG CCCATCCCAT CGGACT 
 Assemble Data

1524R-2.IR_full       1   TGGCACCCAGGAAGGCTAAAGTTCAGAAGGAGGAGGTTCAGGTCCAGCTGGGACCCCAAG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1524R-2.in silico     1   TGGCACCCAGGAAGGCTAAAGTTCAGAAGGAGGAGGTTCAGGTCCAGCTGGGACCCCAAG 60


1524R-2.IR_full       61  TTCGCGACGGCGAGNATCGTGTTCGGAGTGGCTCACATCTACGCCAGCTTCAACGACACC 120
                          |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
1524R-2.in silico     61  TTCGCGACGGCGAG-ATCGTGTTCGGAGTGGCTCACATCTACGCCAGCTTCAACGACACC 120


1524R-2.IR_full       121 TTCGTCCATGTCACTGATCTGTCCGGCCGTGAGACCATCGCTCGTGTCACCGGAGGCATG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1524R-2.in silico     121 TTCGTCCATGTCACTGATCTGTCCGGCCGTGAGACCATCGCTCGTGTCACCGGAGGCATG 180


1524R-2.IR_full       181 AAGGTGAAGGCCGATCGTGATGAGGCTTCGCCCTACGCCGCTATGTTGGCCGCTCAGGAT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1524R-2.in silico     181 AAGGTGAAGGCCGATCGTGATGAGGCTTCGCCCTACGCCGCTATGTTGGCCGCTCAGGAT 240


1524R-2.IR_full       241 GTGGCTGAGAAGTGCAAGACANCTGGGCATCACTGCCCTGCATATTAAGCTGCGTGCCAC 300
                          ||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||
1524R-2.in silico     241 GTGGCTGAGAAGTGCAAGACA-CTGGGCATTACTGCCCTGCATATTAAGCTGCGTGCCAC 300


1524R-2.IR_full       301 CGGCGGCAACAAGACCAAGACCCCCGGACCCGGCGCCCAGTCCGCTCTGCGTGCTTTGGC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1524R-2.in silico     301 CGGCGGCAACAAGACCAAGACCCCCGGACCCGGCGCCCAGTCCGCTCTGCGTGCTTTGGC 360


1524R-2.IR_full       361 CCGTTCGTCCATGAAGATTGGCCGCATCGAGGATGTGACGCCCATCCCATCGGACT 416
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1524R-2.in silico     361 CCGTTCGTCCATGAAGATTGGCCGCATCGAGGATGTGACGCCCATCCCATCGGACT 416

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   396  NM_080145.4  CG1524-RB, transcript variant B (RpS14a), mRNA 
100   396  NM_167137.1  CG1524-RA, transcript variant A (RpS14a), mRNA 
78.53   311  63  17  NM_080427.2  CG1527-RA (RpS14b), mRNA 
0   NM_140688.2  CG7728-RA (CG7728), mRNA 
0   NM_165249.1  CG5803-RB, transcript variant B (Fas3), mRNA 
0   NM_165250.1  CG5803-RA, transcript variant A (Fas3), mRNA 
0   NM_169291.1  CG9381-RB, transcript variant B (mura), mRNA 
0   NM_169292.2  CG9381-RC, transcript variant C (mura), mRNA 
0   NM_141645.2  CG9381-RA, transcript variant A (mura), mRNA 
0   NM_176100.1  CG30492-RC, transcript variant C (CG30492), mRNA 
0   NM_176101.1  CG30492-RE, transcript variant E (CG30492), mRNA 
0   NM_170613.2  CG30492-RA, transcript variant A (CG30492), mRNA 
0   NM_170614.2  CG30492-RB, transcript variant B (CG30492), mRNA 
0   NM_137384.2  CG4878-RB, transcript variant B (eIF3-S9), mRNA 
0   NM_166239.2  CG4878-RA, transcript variant A (eIF3-S9), mRNA 
0   NM_169654.2  CG31302-RC, transcript variant C (CG31302), mRNA 
0   NM_169652.2  CG31302-RA, transcript variant A (CG31302), mRNA 
0   NM_169653.2  CG31302-RB, transcript variant B (CG31302), mRNA 
0   NM_001031986.1  CG33719-RB, transcript variant B (Pif1A), mRNA 
0   NM_080338.3  CG6824-RA, transcript variant A (ovo), mRNA 
0   NM_001038742.1  CG6824-RD, transcript variant D (ovo), mRNA 
0   NM_167027.2  CG6824-RC, transcript variant C (ovo), mRNA 
0   NM_167026.2  CG6824-RB, transcript variant B (ovo), mRNA 
0   NM_001042810.1  CG10952-RB, transcript variant B (eag), mRNA 
0   NM_078603.2  CG10952-RA, transcript variant A (eag), mRNA 
0   NM_136878.2  CG8364-RB, transcript variant B (Rep3), mRNA 
0   NM_136879.2  CG8364-RA, transcript variant A (Rep3), mRNA 
0   16  60  NM_166125.2  CG18255-RA, transcript variant A (Strn-Mlck), mRNA 
0   16  60  NM_166129.2  CG18255-RD, transcript variant D (Strn-Mlck), mRNA 
0   NM_168738.1  CG32184-RA (CG32184), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
++ 
DB
++ 
DC
++ 
DM
++ 
VM
++ 
VB
Caspase-3 signal
N
++ 
DB
++ 
DC
++ 
DM
++ 
VM
++ 
VB
Dcompartment   Penetrance
++     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.