National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 15125R-1 
 Symbol CG15125  Full Name CG15125 
 CG No CG15125  Old CG No CG15125 
 Synonyms CG15125 
 Accession No (Link to NCBI) NM_137593.3 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTCAATCCTCCAGTATGGCCGA 
 Primer Seq. 3'
aatctagaggtaccCGCGTCATTGCTAAAGTTGTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TCAATCCTCC AGTATGGCCG AAAGTCGGAT TTCTCAGGAA AATCCATCGG GACTCGAGCG 
0061 GAGACTTCTG TAGGGACAGC TACACCAAAA ATATTCCGTC GGTCGCTCCT AATACGTATG 
0121 ATGTTCCCAG ACCAATGGGA TTTAAGTACC CGTCAAAGGC AGGATTTTCT GCCTTGGCCA 
0181 ACAAGATGCC ACGATTACCA ATCTTTCGAG AACTGGGATA TCCCCCTATT GGATCCTACG 
0241 CTACCGATTT TCCAGGAACT CAATACTACT TCACTTTCAA CAAGCAAACT GTGCGTGAAC 
0301 AAAAATGGTT GACACCCGGG CCGTCAACCT ATACGCACCA CCTCAAATAT CCGGACTGGG 
0361 ACGTGGAGAC AGCTTTCGGA TCCAAGCGCA TCATCTGGCC AGCAGTGGCC GTATTTTGCA 
0421 GTCCCCAAAA CATTGTCAAA TGCTCGACAT GTGGCGAAAA GCCAGTGGGT GACTATTTTC 
0481 ACAACTTTAG CAANGACGCG  
 in silico PCR Fragment
0001 TCAATCCTCC AGTATGGCCG AAAGTCGGAT TTCTCAGGAA AATCCATCGG GACTCGAGCG 
0061 GAGACTTCTG TAGGGACAGC TACACCAAAA ATATTCCGTC GGTCGCTCCT AATACGTATG 
0121 ATGTTCCCAG ACCAATGGGA TTTAAGTACC CGTCAAAGGC AGGATTTTCT GCCTTGGCCA 
0181 ACAAGATGCC ACGATTACCA ATCTTTCGAG AACTGGGATA TCCCCCTATT GGATCCTACG 
0241 CTACCGATTT TCCAGGAACT CAATACTACT TCACTTTCAA CAAGCAAACT GTGCGTGAAC 
0301 AAAAATGGTT GACACCCGGG CCGTCAACCT ATACGCACCA CCTCAAATAT CCGGACTGGG 
0361 ACGTGGAGAC AGCTTTCGGA TCCAAGCGCA TCATCTGGCC AGCAGTGGCC GTATTTTGCA 
0421 GTCCCCAAAA CATTGTCAAA TGCTCGACAT GTGGCGAAAA GCCAGTGGGT GACTATTTTC 
0481 ACAACTTTAG CAATGACGCG  
 Assemble Data

15125R-1.IR_full       1   TCAATCCTCCAGTATGGCCGAAAGTCGGATTTCTCAGGAAAATCCATCGGGACTCGAGCG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15125R-1.in silico     1   TCAATCCTCCAGTATGGCCGAAAGTCGGATTTCTCAGGAAAATCCATCGGGACTCGAGCG 60


15125R-1.IR_full       61  GAGACTTCTGTAGGGACAGCTACACCAAAAATATTCCGTCGGTCGCTCCTAATACGTATG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15125R-1.in silico     61  GAGACTTCTGTAGGGACAGCTACACCAAAAATATTCCGTCGGTCGCTCCTAATACGTATG 120


15125R-1.IR_full       121 ATGTTCCCAGACCAATGGGATTTAAGTACCCGTCAAAGGCAGGATTTTCTGCCTTGGCCA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15125R-1.in silico     121 ATGTTCCCAGACCAATGGGATTTAAGTACCCGTCAAAGGCAGGATTTTCTGCCTTGGCCA 180


15125R-1.IR_full       181 ACAAGATGCCACGATTACCAATCTTTCGAGAACTGGGATATCCCCCTATTGGATCCTACG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15125R-1.in silico     181 ACAAGATGCCACGATTACCAATCTTTCGAGAACTGGGATATCCCCCTATTGGATCCTACG 240


15125R-1.IR_full       241 CTACCGATTTTCCAGGAACTCAATACTACTTCACTTTCAACAAGCAAACTGTGCGTGAAC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15125R-1.in silico     241 CTACCGATTTTCCAGGAACTCAATACTACTTCACTTTCAACAAGCAAACTGTGCGTGAAC 300


15125R-1.IR_full       301 AAAAATGGTTGACACCCGGGCCGTCAACCTATACGCACCACCTCAAATATCCGGACTGGG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15125R-1.in silico     301 AAAAATGGTTGACACCCGGGCCGTCAACCTATACGCACCACCTCAAATATCCGGACTGGG 360


15125R-1.IR_full       361 ACGTGGAGACAGCTTTCGGATCCAAGCGCATCATCTGGCCAGCAGTGGCCGTATTTTGCA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15125R-1.in silico     361 ACGTGGAGACAGCTTTCGGATCCAAGCGCATCATCTGGCCAGCAGTGGCCGTATTTTGCA 420


15125R-1.IR_full       421 GTCCCCAAAACATTGTCAAATGCTCGACATGTGGCGAAAAGCCAGTGGGTGACTATTTTC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15125R-1.in silico     421 GTCCCCAAAACATTGTCAAATGCTCGACATGTGGCGAAAAGCCAGTGGGTGACTATTTTC 480


15125R-1.IR_full       481 ACAACTTTAGCAANGACGCG 500
                           ||||||||||||| ||||||
15125R-1.in silico     481 ACAACTTTAGCAATGACGCG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_137593.3  CG15125-RA (CG15125), mRNA 
0   NM_141107.3  CG7407-RA (CG7407), mRNA 
0   NM_143026.1  CG6879-RA (CG6879), mRNA 
0   NM_168546.1  CG10732-RA, transcript variant A (CG10732), mRNA 
0   NM_134772.2  CG31937-RA (CG31937), mRNA 
0   NM_136005.1  CG15144-RA (CG15144), mRNA 
0   NM_170075.1  CG31225-RA (CG31225), mRNA 
0   NM_167006.1  CG32774-RA (CG32774), mRNA 
0   NM_165163.1  CG4952-RE, transcript variant E (dac), mRNA 
0   NM_001014487.1  CG4952-RF, transcript variant F (dac), mRNA 
0   NM_165161.1  CG4952-RD, transcript variant D (dac), mRNA 
0   NM_165162.1  CG4952-RB, transcript variant B (dac), mRNA 
0   NM_001014486.1  CG4952-RG, transcript variant G (dac), mRNA 
0   NM_165159.1  CG4952-RC, transcript variant C (dac), mRNA 
0   NM_165160.1  CG4952-RA, transcript variant A (dac), mRNA 
0   NM_140205.1  CG7560-RA (CG7560), mRNA 
0   NM_078986.2  CG8472-RA, transcript variant A (Cam), mRNA 
0   NM_165870.1  CG8472-RB, transcript variant B (Cam), mRNA 
0   NM_001042818.1  CG5055-RB, transcript variant B (baz), mRNA 
0   NM_206774.1  CG12348-RF, transcript variant F (Sh), mRNA 
0   NM_167596.3  CG12348-RA, transcript variant A (Sh), mRNA 
0   NM_167309.1  CG32663-RA (CG32663), mRNA 
0   NM_169834.1  CG7720-RA, transcript variant A (CG7720), mRNA 
0   NM_142496.2  CG7720-RB, transcript variant B (CG7720), mRNA 
0   NM_141532.2  CG9613-RA (CG9613), mRNA 
0   NM_164899.1  CG5686-RA (chico), mRNA 
0   NM_165659.1  CG8024-RC, transcript variant C (ltd), mRNA 
0   NM_165658.1  CG8024-RD, transcript variant D (ltd), mRNA 
0   NM_165660.1  CG8024-RE, transcript variant E (ltd), mRNA 
0   NM_176499.1  CG33101-RA (Nsf2), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.