National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 15118R-4 
 Symbol CG15118  Full Name CG15118 
 CG No CG15118  Old CG No CG15118 
 Synonyms anon-EST:fe1H12, CG15118, anon-fast-evolving-1H12 
 Accession No (Link to NCBI) NM_166325.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAGGAGCGTCGAGGAGATCAAA 
 Primer Seq. 3'
aatctagaggtaccCAGGTGTTGTTGTCGAAGCCC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AGGAGCGTCG AGGAGATCAA NAGCGGAGTA CCCGCTGCAC TGGCACATCT GGCACAACGA 
0061 ACTGGAGCAG CTGCAGGCGG CCATCGACCA GAACGATAAG GAGAAAATCG ATCCCCGCGG 
0121 CCGGACGCCA CTGATGCTGG CTGTGAGATT GGCCAATTTG CCATGCGTTA AATGCCTTCT 
0181 GGCGGCCAAA TGCAATGCGA CCTATGAGCA CGAAGGCTGG TCGATTGTCC AGGAAGCGGT 
0241 CTGCACCGGC GATGTGGACA TACTGACGGC CATCATCGAA GTCCGGGATC TCCAGCGTCA 
0301 TGTCCAGCGG GTTACGCATG TGCCCTAANG CTGCTGCAGC ACCTATTGGA CGCACCAGAT 
0361 TTCTACATCG AGATGAAGTG GGAATTCACC TCCTGGGTGC CCTCTGATGT CGCGTCTCTG 
0421 TCCCAGCGAC ACCTACAAGG TCTACAAGCG GGGAGCCAAC GTCCCGGATA GATACCANCC 
0481 TGCTGGGCTT cGACAACAAC ACCTG 
 in silico PCR Fragment
0001 AGGAGCGTCG AGGAGATCAA -AGCGGAGTA CCCGCTGCAC TGGCACATCT GGCACAACGA 
0061 ACTGGAGCAG CTGCAGGCGG CCATCGACCA GAACGATAAG GAGAAAATCG ATCCCCGCGG 
0121 CCGGACGCCA CTGATGCTGG CTGTGAGATT GGCCAATTTG CCATGCGTTA AATGCCTTCT 
0181 GGCGGCCAAA TGCAATGCGA CCTATGAGTA CGAAGGCTGG TCGATTGTCC AGGAAGCGGT 
0241 CTGCACCGGC GATGTGGACA TACTGACGGC CATCATCGAA GTCCGGGATC TCCAGCGTCA 
0301 TGTCCAGCGG GTTACGCATG TG-CCTAA-G CTGCTGCAGC ACCTATTGGA CGCACCAGAT 
0361 TTCTACATCG AGATGAAGTG GGAATTCACC TCCTGGGTG- CCTCTGATGT CGCGTCTCTG 
0421 TCCCAGCGAC ACCTACAAGG TCTACAAGCG GGGAGCCAAC GT-CCGGATA GATACCACCC 
0481 TGCTGGGCTT CGACAACAAC ACCTG 
 Assemble Data

15118R-4.IR_full       1   AGGAGCGTCGAGGAGATCAANAGCGGAGTACCCGCTGCACTGGCACATCTGGCACAACGA 60
                           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
15118R-4.in silico     1   AGGAGCGTCGAGGAGATCAA-AGCGGAGTACCCGCTGCACTGGCACATCTGGCACAACGA 60


15118R-4.IR_full       61  ACTGGAGCAGCTGCAGGCGGCCATCGACCAGAACGATAAGGAGAAAATCGATCCCCGCGG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15118R-4.in silico     61  ACTGGAGCAGCTGCAGGCGGCCATCGACCAGAACGATAAGGAGAAAATCGATCCCCGCGG 120


15118R-4.IR_full       121 CCGGACGCCACTGATGCTGGCTGTGAGATTGGCCAATTTGCCATGCGTTAAATGCCTTCT 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15118R-4.in silico     121 CCGGACGCCACTGATGCTGGCTGTGAGATTGGCCAATTTGCCATGCGTTAAATGCCTTCT 180


15118R-4.IR_full       181 GGCGGCCAAATGCAATGCGACCTATGAGCACGAAGGCTGGTCGATTGTCCAGGAAGCGGT 240
                           |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
15118R-4.in silico     181 GGCGGCCAAATGCAATGCGACCTATGAGTACGAAGGCTGGTCGATTGTCCAGGAAGCGGT 240


15118R-4.IR_full       241 CTGCACCGGCGATGTGGACATACTGACGGCCATCATCGAAGTCCGGGATCTCCAGCGTCA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15118R-4.in silico     241 CTGCACCGGCGATGTGGACATACTGACGGCCATCATCGAAGTCCGGGATCTCCAGCGTCA 300


15118R-4.IR_full       301 TGTCCAGCGGGTTACGCATGTGCCCTAANGCTGCTGCAGCACCTATTGGACGCACCAGAT 360
                           |||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||
15118R-4.in silico     301 TGTCCAGCGGGTTACGCATGTG-CCTAA-GCTGCTGCAGCACCTATTGGACGCACCAGAT 360


15118R-4.IR_full       361 TTCTACATCGAGATGAAGTGGGAATTCACCTCCTGGGTGCCCTCTGATGTCGCGTCTCTG 420
                           ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
15118R-4.in silico     361 TTCTACATCGAGATGAAGTGGGAATTCACCTCCTGGGTG-CCTCTGATGTCGCGTCTCTG 420


15118R-4.IR_full       421 TCCCAGCGACACCTACAAGGTCTACAAGCGGGGAGCCAACGTCCCGGATAGATACCANCC 480
                           |||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||
15118R-4.in silico     421 TCCCAGCGACACCTACAAGGTCTACAAGCGGGGAGCCAACGT-CCGGATAGATACCACCC 480


15118R-4.IR_full       481 TGCTGGGCTTCGACAACAACACCTG 505
                           |||||||||||||||||||||||||
15118R-4.in silico     481 TGCTGGGCTTCGACAACAACACCTG 505

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_166326.1  CG15118-RC, transcript variant C (CG15118), mRNA 
100   482  NM_166325.1  CG15118-RA, transcript variant A (CG15118), mRNA 
100   482  NM_137552.2  CG15118-RB, transcript variant B (CG15118), mRNA 
81.95   395  10  NM_166327.1  CG15118-RD, transcript variant D (CG15118), mRNA 
0.2   NM_176254.1  CG5403-RB, transcript variant B (retn), mRNA 
0.2   NM_057516.3  CG5403-RA, transcript variant A (retn), mRNA 
0   NM_078759.2  CG11020-RA, transcript variant A (nompC), mRNA 
0   NM_205912.1  CG11020-RB, transcript variant B (nompC), mRNA 
0   25  NM_001032051.1  CG33715-RD, transcript variant D (Msp-300), mRNA 
0   19  NM_001032053.1  CG33715-RB, transcript variant B (Msp-300), mRNA 
0   NM_142213.1  CG14870-RA (CG14870), mRNA 
0   NM_168297.1  CG32026-RA (CG32026), mRNA 
0   NM_164692.2  CG31638-RA (CG31638), mRNA 
0   NM_142053.1  CG14366-RA (CG14366), mRNA 
0   NM_142263.2  CG5013-RA (CG5013), mRNA 
0   NM_057576.3  CG6407-RA (Wnt5), mRNA 
0   NM_169649.1  CG5044-RB, transcript variant B (CG5044), mRNA 
0   NM_142196.2  CG5044-RA, transcript variant A (CG5044), mRNA 
0   NM_134850.2  CG3210-RA (Drp1), mRNA 
0   NM_140200.1  CG6175-RB (CG6175), mRNA 
0   NM_132559.1  CG2750-RA (CG2750), mRNA 
0   10  NM_142819.1  CG6954-RA (CG6954), mRNA 
0   NM_164852.1  CG3694-RC, transcript variant C (Ggamma30A), mRNA 
0   NM_080068.2  CG3694-RA, transcript variant A (Ggamma30A), mRNA 
0   NM_001031985.1  CG33720-RA, transcript variant A (Pif1B), mRNA 
0   NM_001031986.1  CG33719-RB, transcript variant B (Pif1A), mRNA 
0   NM_176694.1  CG3126-RB, transcript variant B (C3G), mRNA 
0   NM_132122.2  CG3126-RA, transcript variant A (C3G), mRNA 
0   NM_001031987.1  CG33719-RA, transcript variant A (Pif1A), mRNA 
0   NM_141239.1  CG17735-RA (CG17735), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
DC
DM
+- 
VM
 
VB
 
Caspase-3 signal
N
 
DB
++ 
DC
++ 
DM
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.