National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 15117R-4 
 Symbol CG15117  Full Name CG15117 
 CG No CG15117  Old CG No CG15117 
 Synonyms CG15117 
 Accession No (Link to NCBI)  
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCTGGACGGGATCTGGAACTTT 
 Primer Seq. 3'
aatctagaggtaccCTGTGGATTCCCGCATAGTTA 
 Predicted Fragment Size
500 
 IR fragment full Seq
 
 in silico PCR Fragment
 
 Assemble Data

15117R-4.IR full       1   CTGGACGGGATCTGGAACTTTGTGCGCTCCGACCAGGCGAATCCCACGCAGGGCGTCCGG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15117R-4.in silico     1   CTGGACGGGATCTGGAACTTTGTGCGCTCCGACCAGGCGAATCCCACGCAGGGCGTCCGG 60


15117R-4.IR full       61  GATGAGTGGTATGCCAAGGAGTTGAGCAAGAGCAGGCCCACAATACCCATGCCGGGTGCC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
15117R-4.in silico     61  GATGAGTGGTATGCCAAGGAGTTGAGCAAGAGCAGGCCCACAATACCCATGCCGG-TGCC 120


15117R-4.IR full       121 GGCATCCTATAATGACATAACCACGGACAATTTGAGGGATCACGTGGGCACAGTGTGGTA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15117R-4.in silico     121 GGCATCCTATAATGACATAACCACGGACAATTTGAGGGATCACGTGGGCACAGTGTGGTA 180


15117R-4.IR full       181 CGACCGCAAGTTCTTTGTGCCCCGATCCTGGTCAAAGGATCAGAGAATATGGCTGCGATT 240
                           ||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||
15117R-4.in silico     181 CGACCGCAAGTTCTTTGTGCCCCGATCGTGGTCAAAGGATCAGAGGATATGGCTGCGATT 240


15117R-4.IR full       241 CGGCAGTGTTCACTATGAGGCATATGTGTGGATCAACGGCCAGAAGGTGGTGAAGCATGA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15117R-4.in silico     241 CGGCAGTGTTCACTATGAGGCATATGTGTGGATCAACGGCCAGAAGGTGGTGAAGCATGA 300


15117R-4.IR full       301 AATGGGTCACCTACCCTTCGAGGCGGAGGTCACCGATCTTCTGAGCTATGGAGCCGAGAA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15117R-4.in silico     301 AATGGGTCACCTACCCTTCGAGGCGGAGGTCACCGATCTTCTGAGCTATGGAGCCGAGAA 360


15117R-4.IR full       361 TCGGATCACCGTTATGTGCGACAATGCTCTGATTCAGACAACTGTGCCGCAGGGCAGGAT 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15117R-4.in silico     361 TCGGATCACCGTTATGTGCGACAATGCTCTGATTCAGACAACTGTGCCGCAGGGCAGGAT 420


15117R-4.IR full       421 TACGGAAGTGCCCAACGATGGTGGCATGACCATTGTGNAGAGCTACACCTTTGACTTCTT 480
                           ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||
15117R-4.in silico     421 TACGGAAGTGCCCAACGATGGTGGCATGACCATTGTGCAGAGCTACACCTTTGACTTCTT 480


15117R-4.IR full       481 TAACTATGCGGGAATCCACAGG 502
                           ||||||||||||||||||||| 
15117R-4.in silico     481 TAACTATGCGGGAATCCACAG- 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100  482  NM_137551.2  CG15117-RA, transcript variant A (CG15117), mRNA 
100  482  NM_166324.1  CG15117-RB, transcript variant B (CG15117), mRNA 
100  482  NM_001014535.1  CG15117-RC, transcript variant C (CG15117), mRNA 
0.2  NM_136518.3  CG2183-RA (CG2183), mRNA 
36  NM_143636.1  CG2135-RA (CG2135), mRNA 
NM_206008.1  CG33316-RB, transcript variant B (CG33316), mRNA 
NM_206007.1  CG33316-RA, transcript variant A (CG33316), mRNA 
NM_144077.2  CG18675-RA (CG18675), mRNA 
NM_166844.1  CG17896-RA, transcript variant A (CG17896), mRNA 
NM_130489.2  CG17896-RB, transcript variant B (CG17896), mRNA 
NM_001043131.1  CG33274-RB (CG33274), mRNA 
NM_135080.1  CG12512-RA (CG12512), mRNA 
NM_001043144.1  CG4998-RB, transcript variant B (CG4998), mRNA 
NM_131920.2  CG6379-RA (CG6379), mRNA 
NM_166664.1  tamo CG4057-RA, transcript variant A (tamo), mRNA 
NM_136783.2  CG30020-RA (CG30020), mRNA 
NM_138045.2  tamo CG4057-RB, transcript variant B (tamo), mRNA 
NM_139809.2  CG18156-RA (CG18156), mRNA 
NM_138050.2  CG3363-RA (CG3363), mRNA 
11  NM_166487.2  CG13492-RB, transcript variant B (CG13492), mRNA 
11  NM_137768.1  CG13492-RA, transcript variant A (CG13492), mRNA 
NM_140210.1  CG6140-RA (CG6140), mRNA 
NM_080121.2  greatwall CG7719-RA (gwl), mRNA 
NM_137535.2  CG15098-RA (CG15098), mRNA 
NM_078606.3  Topoisomerase 1 CG6146-RA, transcript variant A (Top1), mRNA 
NM_132487.1  CG15196-RA (CG15196), mRNA 
NM_001014742.1  Topoisomerase 1 CG6146-RC, transcript variant C (Top1), mRNA 
NM_167435.2  Topoisomerase 1 CG6146-RB, transcript variant B (Top1), mRNA 
NM_132026.1  CG4078-RA (CG4078), mRNA 
NM_170158.1  CG5794-RB, transcript variant B (CG5794), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
DM
 
VM
 
VB
 
Caspase-3 signal
N
DB
DC
DM
 
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.