National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 15117R-1 
 Symbol CG15117  Full Name CG15117 
 CG No CG15117  Old CG No CG15117 
 Synonyms CG15117 
 Accession No (Link to NCBI)  
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCTGGACGGGATCTGGAACTTT 
 Primer Seq. 3'
aatctagaggtaccCTGTGGATTCCCGCATAGTTA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CTGGACGGGA TCTGGAACTT TGTGCGCTCC GACCAGGCGA ATCCCACGCA GGGCGTCCGG 
0061 GATGAGTGGT ATGCCAAGGA GTTGAGCAAG AGCAGGCCCA CAATACCCAT GCCGGGTGCC 
0121 GGCATCCTAT AATGACATAA CCACGGACAA TTTGAGGGAT CACGTGGGCA CAGTGTGGTA 
0181 CGACCGCAAG TTCTTTGTGC CCCGATCCTG GTCAAAGGAT CAGAGAATAT GGCTGCGATT 
0241 CGGCAGTGTT CACTATGAGG CATATGTGTG GATCAACGGC CAGAAGGTGG TGAAGCATGA 
0301 AATGGGTCAC CTACCCTTCG AGGCGGAGGT CACCGATCTT CTGAGCTATG GAGCCGAGAA 
0361 TCGGATCACC GTTATGTGCG ACAATGCTCT GATTCAGACA ACTGTGCCGC AGGGCAGGAT 
0421 TACGGAAGTG CCCAACGATG GTGGCATGAC CATTGTGNAG AGCTACACCT TTGACTTCTT 
0481 TAACTATGCG GGAATCCACA GG 
 in silico PCR Fragment
0001 ctggacggga tctggaactt tgtgcgctcc gaccaggcga atcccacgca gggcgtccgg 
0061 gatgagtggt atgccaagga gttgagcaag agcaggccca caatacccat gccggtgccg 
0121 gcatcctata atgacataac cacggacaat ttgagggatc acgtgggcac agtgtggtac 
0181 gaccgcaagt tctttgtgcc ccgatcgtgg tcaaaggatc agaggatatg gctgcgattc 
0241 ggcagtgttc actatgaggc atatgtgtgg atcaacggcc agaaggtggt gaagcatgaa 
0301 atgggtcacc tacccttcga ggcggaggtc accgatcttc tgagctatgg agccgagaat 
0361 cggatcaccg ttatgtgcga caatgctctg attcagacaa ctgtgccgca gggcaggatt 
0421 acggaagtgc ccaacgatgg tggcatgacc attgtgcaga gctacacctt tgacttcttt 
0481 aactatgcgg gaatccacag  
 Assemble Data

15117R-1.IR full       1   CTGGACGGGATCTGGAACTTTGTGCGCTCCGACCAGGCGAATCCCACGCAGGGCGTCCGG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15117R-1.in silico     1   CTGGACGGGATCTGGAACTTTGTGCGCTCCGACCAGGCGAATCCCACGCAGGGCGTCCGG 60


15117R-1.IR full       61  GATGAGTGGTATGCCAAGGAGTTGAGCAAGAGCAGGCCCACAATACCCATGCCGGGTGCC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
15117R-1.in silico     61  GATGAGTGGTATGCCAAGGAGTTGAGCAAGAGCAGGCCCACAATACCCATGCCGG-TGCC 120


15117R-1.IR full       121 GGCATCCTATAATGACATAACCACGGACAATTTGAGGGATCACGTGGGCACAGTGTGGTA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15117R-1.in silico     121 GGCATCCTATAATGACATAACCACGGACAATTTGAGGGATCACGTGGGCACAGTGTGGTA 180


15117R-1.IR full       181 CGACCGCAAGTTCTTTGTGCCCCGATCCTGGTCAAAGGATCAGAGAATATGGCTGCGATT 240
                           ||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||
15117R-1.in silico     181 CGACCGCAAGTTCTTTGTGCCCCGATCGTGGTCAAAGGATCAGAGGATATGGCTGCGATT 240


15117R-1.IR full       241 CGGCAGTGTTCACTATGAGGCATATGTGTGGATCAACGGCCAGAAGGTGGTGAAGCATGA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15117R-1.in silico     241 CGGCAGTGTTCACTATGAGGCATATGTGTGGATCAACGGCCAGAAGGTGGTGAAGCATGA 300


15117R-1.IR full       301 AATGGGTCACCTACCCTTCGAGGCGGAGGTCACCGATCTTCTGAGCTATGGAGCCGAGAA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15117R-1.in silico     301 AATGGGTCACCTACCCTTCGAGGCGGAGGTCACCGATCTTCTGAGCTATGGAGCCGAGAA 360


15117R-1.IR full       361 TCGGATCACCGTTATGTGCGACAATGCTCTGATTCAGACAACTGTGCCGCAGGGCAGGAT 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15117R-1.in silico     361 TCGGATCACCGTTATGTGCGACAATGCTCTGATTCAGACAACTGTGCCGCAGGGCAGGAT 420


15117R-1.IR full       421 TACGGAAGTGCCCAACGATGGTGGCATGACCATTGTGNAGAGCTACACCTTTGACTTCTT 480
                           ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||
15117R-1.in silico     421 TACGGAAGTGCCCAACGATGGTGGCATGACCATTGTGCAGAGCTACACCTTTGACTTCTT 480


15117R-1.IR full       481 TAACTATGCGGGAATCCACAGG 502
                           ||||||||||||||||||||| 
15117R-1.in silico     481 TAACTATGCGGGAATCCACAG- 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100  482  NM_137551.2  CG15117-RA, transcript variant A (CG15117), mRNA 
100  482  NM_166324.1  CG15117-RB, transcript variant B (CG15117), mRNA 
100  482  NM_001014535.1  CG15117-RC, transcript variant C (CG15117), mRNA 
0.2  NM_136518.3  CG2183-RA (CG2183), mRNA 
36  NM_143636.1  CG2135-RA (CG2135), mRNA 
NM_206008.1  CG33316-RB, transcript variant B (CG33316), mRNA 
NM_206007.1  CG33316-RA, transcript variant A (CG33316), mRNA 
NM_144077.2  CG18675-RA (CG18675), mRNA 
NM_166844.1  CG17896-RA, transcript variant A (CG17896), mRNA 
NM_130489.2  CG17896-RB, transcript variant B (CG17896), mRNA 
NM_001043131.1  CG33274-RB (CG33274), mRNA 
NM_135080.1  CG12512-RA (CG12512), mRNA 
NM_001043144.1  CG4998-RB, transcript variant B (CG4998), mRNA 
NM_131920.2  CG6379-RA (CG6379), mRNA 
NM_166664.1  tamo CG4057-RA, transcript variant A (tamo), mRNA 
NM_136783.2  CG30020-RA (CG30020), mRNA 
NM_138045.2  tamo CG4057-RB, transcript variant B (tamo), mRNA 
NM_139809.2  CG18156-RA (CG18156), mRNA 
NM_138050.2  CG3363-RA (CG3363), mRNA 
11  NM_166487.2  CG13492-RB, transcript variant B (CG13492), mRNA 
11  NM_137768.1  CG13492-RA, transcript variant A (CG13492), mRNA 
NM_140210.1  CG6140-RA (CG6140), mRNA 
NM_080121.2  greatwall CG7719-RA (gwl), mRNA 
NM_137535.2  CG15098-RA (CG15098), mRNA 
NM_078606.3  Topoisomerase 1 CG6146-RA, transcript variant A (Top1), mRNA 
NM_132487.1  CG15196-RA (CG15196), mRNA 
NM_001014742.1  Topoisomerase 1 CG6146-RC, transcript variant C (Top1), mRNA 
NM_167435.2  Topoisomerase 1 CG6146-RB, transcript variant B (Top1), mRNA 
NM_132026.1  CG4078-RA (CG4078), mRNA 
NM_170158.1  CG5794-RB, transcript variant B (CG5794), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.