National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 15111R-3 
 Symbol CG15111  Full Name CG15111 
 CG No CG15111  Old CG No CG15111 
 Synonyms CG15111 
 Accession No (Link to NCBI) NM_137553.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGTCTGCTGATCTTCTTCCTG 
 Primer Seq. 3'
aatctagaggtaccTTATACACCTCCGATCGGTGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TGTCTGCTGA TCTTCTTCCT GATCTTCGTG GTCCTACCGT TGATCTTTCG GTATTCCGTA 
0061 ACGTTCCAGC GTGGCATCCT ATTTCTGACA TTTATTAAGT ATCCCAAAGG ACTTGATCTC 
0121 ACCAAGCCGG AAAGCGTGGG TCTTTATGCC ACACGAAACT TCTACATAAC CGTAAAGGAT 
0181 CACGATCAGG ACGAGGATGG AGTGCGAGTT GGTGTGTGGC ACGTGCTGCC CAGCAATGCA 
0241 GTGCGTCGTT TTAAGCGCGA ACTGCGCGTG GAGGAGGAAG TGGCCCAGGA CCCGGATCAG 
0301 CAGCTGGATC CTGCACCTGG CAACGAACGC GAGCTGAAgG NGNTATCGCC AGCCATACGA 
0361 TCTGAATTTC CCGTCGTGCT GCCGGAAAAC GAGCAGCTCT TCTATGAGCG ATTGCTGCGG 
0421 ATGCCCGGCG GTACTGTGGT CCTCTATCTT CATGGGAACA CAGCCAGCCG GGGCAGTGGT 
0481 CACCGATCGG AGGTGTATAA  
 in silico PCR Fragment
0001 TGTCTGCTGA TCTTCTTCCT GATCTTCGTG GTCCTACCGT TGATCTTTCG GTATTCCGTA 
0061 ACGTTCCAGC GTGGCATCCT ATTTCTGACA TTTATTAAGT ATCCCAAAGG ACTTGATCTC 
0121 ACCAAGCCGG AAAGCGTGGG TCTTTATGCC ACACGAAACT TCTACATAAC CGTAAAGGAT 
0181 CACGATCAGG ACGAGGATGG AGTGCGAGTT GGTGTGTGGC ACGTGCTGCC CAGCAATGCA 
0241 GTGCGTCGTT TTAAGCGCGA ACTGCGCGTG GAGGAGGAAG TGGCCCAGGA CCCGGATCAG 
0301 CAGCTGGATC CTGCACCTGG CAACGAACGC GAGCTGAAGG AGCTATCGCC AGCCATACGA 
0361 TCTGAATTTC CCGTCGTGCT GCCGGAAAAC GAGCAGCTCT TCTATGAGCG ATTGCTGCGG 
0421 ATGCCCGGCG GTACTGTGGT CCTCTATCTT CATGGGAACA CAGCCAGCCG GGGCAGTGGT 
0481 CACCGATCGG AGGTGTATAA  
 Assemble Data

15111R-3.IR_full       1   TGTCTGCTGATCTTCTTCCTGATCTTCGTGGTCCTACCGTTGATCTTTCGGTATTCCGTA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15111R-3.in silico     1   TGTCTGCTGATCTTCTTCCTGATCTTCGTGGTCCTACCGTTGATCTTTCGGTATTCCGTA 60


15111R-3.IR_full       61  ACGTTCCAGCGTGGCATCCTATTTCTGACATTTATTAAGTATCCCAAAGGACTTGATCTC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15111R-3.in silico     61  ACGTTCCAGCGTGGCATCCTATTTCTGACATTTATTAAGTATCCCAAAGGACTTGATCTC 120


15111R-3.IR_full       121 ACCAAGCCGGAAAGCGTGGGTCTTTATGCCACACGAAACTTCTACATAACCGTAAAGGAT 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15111R-3.in silico     121 ACCAAGCCGGAAAGCGTGGGTCTTTATGCCACACGAAACTTCTACATAACCGTAAAGGAT 180


15111R-3.IR_full       181 CACGATCAGGACGAGGATGGAGTGCGAGTTGGTGTGTGGCACGTGCTGCCCAGCAATGCA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15111R-3.in silico     181 CACGATCAGGACGAGGATGGAGTGCGAGTTGGTGTGTGGCACGTGCTGCCCAGCAATGCA 240


15111R-3.IR_full       241 GTGCGTCGTTTTAAGCGCGAACTGCGCGTGGAGGAGGAAGTGGCCCAGGACCCGGATCAG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15111R-3.in silico     241 GTGCGTCGTTTTAAGCGCGAACTGCGCGTGGAGGAGGAAGTGGCCCAGGACCCGGATCAG 300


15111R-3.IR_full       301 CAGCTGGATCCTGCACCTGGCAACGAACGCGAGCTGAAGGNGNTATCGCCAGCCATACGA 360
                           |||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||
15111R-3.in silico     301 CAGCTGGATCCTGCACCTGGCAACGAACGCGAGCTGAAGGAGCTATCGCCAGCCATACGA 360


15111R-3.IR_full       361 TCTGAATTTCCCGTCGTGCTGCCGGAAAACGAGCAGCTCTTCTATGAGCGATTGCTGCGG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15111R-3.in silico     361 TCTGAATTTCCCGTCGTGCTGCCGGAAAACGAGCAGCTCTTCTATGAGCGATTGCTGCGG 420


15111R-3.IR_full       421 ATGCCCGGCGGTACTGTGGTCCTCTATCTTCATGGGAACACAGCCAGCCGGGGCAGTGGT 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15111R-3.in silico     421 ATGCCCGGCGGTACTGTGGTCCTCTATCTTCATGGGAACACAGCCAGCCGGGGCAGTGGT 480


15111R-3.IR_full       481 CACCGATCGGAGGTGTATAA 500
                           ||||||||||||||||||||
15111R-3.in silico     481 CACCGATCGGAGGTGTATAA 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_166328.1  CG15111-RB, transcript variant B (CG15111), mRNA 
100   482  NM_137553.1  CG15111-RA, transcript variant A (CG15111), mRNA 
0   10  NM_079994.3  CG12630-RA (tio), mRNA 
0   NM_170652.1  CG6643-RA, transcript variant A (CG6643), mRNA 
0   NM_170653.1  CG6643-RB, transcript variant B (CG6643), mRNA 
0   NM_206344.1  CG4357-RB, transcript variant B (Ncc69), mRNA 
0   NM_140315.3  CG4357-RA, transcript variant A (Ncc69), mRNA 
0   NM_057619.3  CG3710-RA (TfIIS), mRNA 
0   NM_164967.1  CG6509-RA, transcript variant A (CG6509), mRNA 
0   NM_135661.2  CG6509-RB, transcript variant B (CG6509), mRNA 
0   NM_132292.2  CG7246-RA (CG7246), mRNA 
0   10  NM_057556.3  CG4088-RA, transcript variant A (lat), mRNA 
0   10  NM_165971.1  CG4088-RB, transcript variant B (lat), mRNA 
0   NM_137274.2  CG4282-RA (CG4282), mRNA 
0   NM_137386.2  CG18631-RA (CG18631), mRNA 
0   NM_137883.1  CG13535-RA (CG13535), mRNA 
0   NM_176249.1  CG13517-RB, transcript variant B (Obp59a), mRNA 
0   NM_137863.1  CG13517-RA, transcript variant A (Obp59a), mRNA 
0   NM_001014729.1  CG32697-RE, transcript variant E (l(1)G0232), mRNA 
0   NM_167199.1  CG32697-RD, transcript variant D (l(1)G0232), mRNA 
0   NM_167198.1  CG32697-RB, transcript variant B (l(1)G0232), mRNA 
0   NM_132348.2  CG32697-RA, transcript variant A (l(1)G0232), mRNA 
0   NM_001014728.1  CG32697-RF, transcript variant F (l(1)G0232), mRNA 
0   NM_167197.1  CG32697-RC, transcript variant C (l(1)G0232), mRNA 
0   NM_079940.4  CG16973-RA, transcript variant A (msn), mRNA 
0   NM_135750.1  CG16800-RA (CG16800), mRNA 
0   NM_140644.1  CG12436-RA (CG12436), mRNA 
0   NM_136464.1  CG2070-RA (CG2070), mRNA 
0   NM_080502.3  CG6054-RA (Su(fu)), mRNA 
0   NM_058119.3  CG18783-RA, transcript variant A (Kr-h1), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.