National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 15022R-1 
 Symbol CG15022  Full Name CG15022 
 CG No CG15022  Old CG No CG15022 
 Synonyms BcDNA:RE24507, CG15022 
 Accession No (Link to NCBI) NM_139648.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCTGATCCTTTTGGCTCTGGCA 
 Primer Seq. 3'
aatctagaggtaccGGAGGCAGATATGTGGGCTTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CTGATCCTTT TGGCTCTGGC AGGCTTTGCC ATCTGTATTC GGGCAGACGT GTCCCACCTG 
0061 TACGGAGGAG GTTACCACGA TCACGGCCAT GATCACCATC ACCACCATGA TCACGATCAC 
0121 GATCATGATC ACCACCACTA TGATGTCCAT TCCCACCACC ATTCTCCCTC GTCACACGAT 
0181 CATCATGATC TGCACATTGA TCTGCACTAT CAGCCGGATC ACCACCATCA TCATCATCAA 
0241 GAGGCCAAGT TCGATATCCC TAGCGGATAT AGCTATGGAC CTCCAGAGAA ACNCTCGCCA 
0301 GAAGTACCTG CCGCCCAAGG TTTCTCTGCC ACCGCCACCA CCTCCACCGC CCAAGGCAAC 
0361 TTATCTGCCT CCCTCAAAGC CTGAAGTGAA GTACCTGCCC CCCGAACCGG TGGCCAAGTA 
0421 TCTGCCACCC AAGGTCGCTC CCAGCCTGCC TCCTCCACCA CCACCTCCAG TTGTGGCGCC 
0481 CAAGCCCACA TATCTGcCTC C 
 in silico PCR Fragment
0001 CTGATCCTTT TGGCTCTGGC AGGCTTTGCC ATCTGTATTC GGGCAGACGT GTCCCACCTG 
0061 TACGGAGGAG GTTACCACGA TCACGGCCAT GATCACCATC ACCACCATGA TCACGATCAC 
0121 GATCATGATC ACCACCACTA TGATGTCCAT TCCCACCACC ATTCTCCCTC GTCACACGAT 
0181 CATCATGATC TGCACATTGA TCTGCACTAT CAGCCGGATC ACCACCATCA TCATCATCAA 
0241 GAGGCCAAGT TCGATATCCC TAGCGGATAT AGCTATGGAC CTCCAGAGAA AC-CTCGCCA 
0301 GAAGTACCTG CCGCCCAAGG TTTCCCTGCC ACCGCCACCA CCTCCACCGC CCAAGGCAAC 
0361 TTATCTGCCT CCCTCAAAGC CTGAAGTGAA GTACCTGCCC CCCGAACCGG TGGCCAAGTA 
0421 TCTGCCACCC AAGGTCGCTC CCAGCCTGCC TCCTCCACCA CCACCTCCAG TTGTGGCGCC 
0481 CAAGCCCACA TATCTGCCTC C 
 Assemble Data

15022R-1.IR_full       1   CTGATCCTTTTGGCTCTGGCAGGCTTTGCCATCTGTATTCGGGCAGACGTGTCCCACCTG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15022R-1.in silico     1   CTGATCCTTTTGGCTCTGGCAGGCTTTGCCATCTGTATTCGGGCAGACGTGTCCCACCTG 60


15022R-1.IR_full       61  TACGGAGGAGGTTACCACGATCACGGCCATGATCACCATCACCACCATGATCACGATCAC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15022R-1.in silico     61  TACGGAGGAGGTTACCACGATCACGGCCATGATCACCATCACCACCATGATCACGATCAC 120


15022R-1.IR_full       121 GATCATGATCACCACCACTATGATGTCCATTCCCACCACCATTCTCCCTCGTCACACGAT 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15022R-1.in silico     121 GATCATGATCACCACCACTATGATGTCCATTCCCACCACCATTCTCCCTCGTCACACGAT 180


15022R-1.IR_full       181 CATCATGATCTGCACATTGATCTGCACTATCAGCCGGATCACCACCATCATCATCATCAA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15022R-1.in silico     181 CATCATGATCTGCACATTGATCTGCACTATCAGCCGGATCACCACCATCATCATCATCAA 240


15022R-1.IR_full       241 GAGGCCAAGTTCGATATCCCTAGCGGATATAGCTATGGACCTCCAGAGAAACNCTCGCCA 300
                           |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
15022R-1.in silico     241 GAGGCCAAGTTCGATATCCCTAGCGGATATAGCTATGGACCTCCAGAGAAAC-CTCGCCA 300


15022R-1.IR_full       301 GAAGTACCTGCCGCCCAAGGTTTCTCTGCCACCGCCACCACCTCCACCGCCCAAGGCAAC 360
                           |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
15022R-1.in silico     301 GAAGTACCTGCCGCCCAAGGTTTCCCTGCCACCGCCACCACCTCCACCGCCCAAGGCAAC 360


15022R-1.IR_full       361 TTATCTGCCTCCCTCAAAGCCTGAAGTGAAGTACCTGCCCCCCGAACCGGTGGCCAAGTA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15022R-1.in silico     361 TTATCTGCCTCCCTCAAAGCCTGAAGTGAAGTACCTGCCCCCCGAACCGGTGGCCAAGTA 420


15022R-1.IR_full       421 TCTGCCACCCAAGGTCGCTCCCAGCCTGCCTCCTCCACCACCACCTCCAGTTGTGGCGCC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15022R-1.in silico     421 TCTGCCACCCAAGGTCGCTCCCAGCCTGCCTCCTCCACCACCACCTCCAGTTGTGGCGCC 480


15022R-1.IR_full       481 CAAGCCCACATATCTGCCTCC 501
                           |||||||||||||||||||||
15022R-1.in silico     481 CAAGCCCACATATCTGCCTCC 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  36  163  NM_139648.1  CG15022-RA (CG15022), mRNA 
1.86   57  126  NM_080192.2  CG10449-RA (Catsup), mRNA 
0.82   12  25  93  NM_168725.2  CG13731-RA (CG13731), mRNA 
0.82   14  51  NM_139766.1  CG6619-RA (CG6619), mRNA 
0.82   40  147  NM_142330.1  CG5225-RA (CG5225), mRNA 
0.82   31  71  NM_080364.3  CG5461-RA, transcript variant A (bun), mRNA 
0.82   31  71  NM_001042894.1  CG5461-RF, transcript variant F (bun), mRNA 
0.82   22  62  NM_130497.2  CG13363-RA (Suv4-20), mRNA 
0.41   13  15  34  NM_001032399.1  CG33955-RB (eys), mRNA 
0.41   21  NM_169860.2  CG31221-RA, transcript variant A (CG31221), mRNA 
0.41   21  NM_169861.2  CG31221-RB, transcript variant B (CG31221), mRNA 
0.41   19  26  NM_130587.1  CG14799-RA (CG14799), mRNA 
0.41   15  45  NM_166223.1  CG6556-RA (cnk), mRNA 
0.41   29  NM_134618.2  CG14619-RA, transcript variant A (CG14619), mRNA 
0.41   29  NM_167775.1  CG14619-RD, transcript variant D (CG14619), mRNA 
0.41   29  NM_167776.1  CG14619-RE, transcript variant E (CG14619), mRNA 
0.41   25  46  NM_143004.1  CG13615-RA (CG13615), mRNA 
0.41   17  NM_169815.2  CG31122-RA (CG31122), mRNA 
0.41   23  NM_001043222.1  CG9610-RC (Poxm), mRNA 
0.41   20  NM_167218.1  CG32685-RC (CG32685), mRNA 
0.2   10  25  59  NM_131924.2  CG4857-RB (CG4857), mRNA 
0.2   10  20  45  NM_001031889.1  CG33691-RA, transcript variant A (CG33691), mRNA 
0.2   10  20  45  NM_001031886.1  CG33692-RA, transcript variant A (CG33692), mRNA 
0.2   15  NM_133014.2  CG6269-RA (unc-4), mRNA 
0.2   18  54  NM_136041.1  CG10231-RA (Pde11), mRNA 
0.2   15  NM_164485.1  CG9885-RB, transcript variant B (dpp), mRNA 
0.2   17  NM_144354.2  CG6987-RA (SF2), mRNA 
0   NM_142005.1  CG14380-RA (CG14380), mRNA 
0   19  NM_167487.1  CG32577-RA (disco-r), mRNA 
0   40  102  NM_175956.1  CG33003-RA (CG33003), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.