National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 15011R-3 
 Symbol CG15011  Full Name CG15011 
 CG No CG15011  Old CG No CG15011 
 Synonyms CG15011 
 Accession No (Link to NCBI) NM_139622.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Du J, Zhang J, Su Y, Liu M, Ospina JK, Yang S, Zhu AJ.
In vivo RNAi screen reveals neddylation genes as novel regulators of Hedgehog signaling.
PLoS ONE (2011) 6(9) e24168 [ PubMed ID = 21931660 ] [ RRC reference ]

Nitta Y, Yamazaki D, Sugie A, Hiroi M, Tabata T.
DISCO Interacting Protein 2 regulates axonal bifurcation and guidance of Drosophila mushroom body neurons.
Dev. Biol. (2017) 421(2) 233-244 [ PubMed ID = 27908785 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTTGGCTGCCGCCCAAAAACTG 
 Primer Seq. 3'
aatctagaggtaccAAGGGCTGGTTCTCGGGGTTC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TTGGCTGCCG CCCAAAAACT GGTGGACACC TACGCCTCCA GCTCCGAGGA TGAAGGCGAA 
0061 CTGGATGAGA ATCACATTTT GGAACTCCTA TACAAGAACT ACAAACCGTC GGACAACGCA 
0121 GGAAGCTCAA AGGAAGCGGC ACGCACCAGT ACGTTTCTGG AAAACACTCT ACACTCGGGA 
0181 GCGGCAACCT GTCTCATTTG CATCGGAAGC ATTCGGCGGG TGGAGGCCAT TTGGTCTTGC 
0241 GAGAGCTGTT ACTGCTTCTT TCACTTGAAG TGCATCCAAC GGTGGGCCAA CGACAGCATG 
0301 ATGCAGATGA AGGTAAAGGC GGCAGAGCAG CAGAACGGCC AGGGCCACTA CAATCATCTG 
0361 GGCGAATTTG TGCCGCCCAA GCGACAGAAA TCCCTTCACT GGTGCTGCCC CCAGTGCCGC 
0421 AGGGACTACC AACCGGCCGA TAAGCCCACG CAGTACAACT GCTTCTGCGG CAAGGAGGTG 
0481 AACCCCGAGA ACCAGCCCTT  
 in silico PCR Fragment
0001 TTGGCTGCCG CCCAAAAACT GGTGGACACC TACGCCTCCA GCTCCGAGGA TGAAGGCGAA 
0061 CTGGATGAGA ATCACATTTT GGAACTCCTA TACAAGAACT ACAAACCGTC GGACAACGCA 
0121 GGAAGCTCAA AGGAAGCGGC ACGCACCAGT ACGTTTCTGG AAAACACTCT ACACTCGGGA 
0181 GCGGCAACCT GTCTCATTTG CATCGGAAGC ATTCGGCGGG TGGAGGCCAT TTGGTCTTGC 
0241 GAGAGCTGTT ACTGCTTCTT TCACTTGAAG TGCATCCAAC GGTGGGCCAA CGACAGCATG 
0301 ATGCAGATGA AGGTAAAGGC GGCAGAGCAG CAGAACGGCC AGGGCCACTA CAATCATCTG 
0361 GGCGAATTTG TGCCGCCCAA GCGACAGAAA TCCCTTCACT GGTGCTGCCC CAAGTGCCGC 
0421 AGGGACTACC AACCGGCCGA TAAGCCCACG CAGTACAACT GCTTCTGCGG CAAGGAGGTG 
0481 AACCCCGAGA ACCAGCCCTT  
 Assemble Data

15011R-3.IR_full       1   TTGGCTGCCGCCCAAAAACTGGTGGACACCTACGCCTCCAGCTCCGAGGATGAAGGCGAA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15011R-3.in silico     1   TTGGCTGCCGCCCAAAAACTGGTGGACACCTACGCCTCCAGCTCCGAGGATGAAGGCGAA 60


15011R-3.IR_full       61  CTGGATGAGAATCACATTTTGGAACTCCTATACAAGAACTACAAACCGTCGGACAACGCA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15011R-3.in silico     61  CTGGATGAGAATCACATTTTGGAACTCCTATACAAGAACTACAAACCGTCGGACAACGCA 120


15011R-3.IR_full       121 GGAAGCTCAAAGGAAGCGGCACGCACCAGTACGTTTCTGGAAAACACTCTACACTCGGGA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15011R-3.in silico     121 GGAAGCTCAAAGGAAGCGGCACGCACCAGTACGTTTCTGGAAAACACTCTACACTCGGGA 180


15011R-3.IR_full       181 GCGGCAACCTGTCTCATTTGCATCGGAAGCATTCGGCGGGTGGAGGCCATTTGGTCTTGC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15011R-3.in silico     181 GCGGCAACCTGTCTCATTTGCATCGGAAGCATTCGGCGGGTGGAGGCCATTTGGTCTTGC 240


15011R-3.IR_full       241 GAGAGCTGTTACTGCTTCTTTCACTTGAAGTGCATCCAACGGTGGGCCAACGACAGCATG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15011R-3.in silico     241 GAGAGCTGTTACTGCTTCTTTCACTTGAAGTGCATCCAACGGTGGGCCAACGACAGCATG 300


15011R-3.IR_full       301 ATGCAGATGAAGGTAAAGGCGGCAGAGCAGCAGAACGGCCAGGGCCACTACAATCATCTG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15011R-3.in silico     301 ATGCAGATGAAGGTAAAGGCGGCAGAGCAGCAGAACGGCCAGGGCCACTACAATCATCTG 360


15011R-3.IR_full       361 GGCGAATTTGTGCCGCCCAAGCGACAGAAATCCCTTCACTGGTGCTGCCCCCAGTGCCGC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
15011R-3.in silico     361 GGCGAATTTGTGCCGCCCAAGCGACAGAAATCCCTTCACTGGTGCTGCCCCAAGTGCCGC 420


15011R-3.IR_full       421 AGGGACTACCAACCGGCCGATAAGCCCACGCAGTACAACTGCTTCTGCGGCAAGGAGGTG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15011R-3.in silico     421 AGGGACTACCAACCGGCCGATAAGCCCACGCAGTACAACTGCTTCTGCGGCAAGGAGGTG 480


15011R-3.IR_full       481 AACCCCGAGAACCAGCCCTT 500
                           ||||||||||||||||||||
15011R-3.in silico     481 AACCCCGAGAACCAGCCCTT 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_139622.1  CG15011-RA (CG15011), mRNA 
0   NM_079673.2  CG14307-RF, transcript variant F (fru), mRNA 
0   NM_169816.1  CG14307-RB, transcript variant B (fru), mRNA 
0   NM_079475.2  CG32443-RA (Pc), mRNA 
0   NM_137397.1  CG30106-RA (CG30106), mRNA 
0   NM_134869.2  CG2964-RA (CG2964), mRNA 
0   NM_131995.1  CG15784-RA (CG15784), mRNA 
0   NM_001042830.1  CG41474-RA (CG41474), mRNA 
0   NM_143533.1  CG2218-RA (CG2218), mRNA 
0   NM_141657.2  CG8273-RA (CG8273), mRNA 
0   NM_142218.1  CG18522-RA (CG18522), mRNA 
0   NM_001038740.1  CG32776-RD, transcript variant D (CG32776), mRNA 
0   NM_206622.2  CG32776-RB, transcript variant B (CG32776), mRNA 
0   NM_134786.4  CG7337-RA, transcript variant A (CG7337), mRNA 
0   NM_164576.2  CG15427-RD, transcript variant D (tutl), mRNA 
0   NM_001042862.1  CG7337-RC, transcript variant C (CG7337), mRNA 
0   NM_001042863.1  CG7337-RB, transcript variant B (CG7337), mRNA 
0   NM_080049.2  CG11614-RA (nkd), mRNA 
0   NM_141798.1  CG10703-RA (CG10703), mRNA 
0   NM_079511.3  CG10609-RA (Or83b), mRNA 
0   NM_079074.1  CG13441-RA (Gr57a), mRNA 
0   NM_170245.1  CG17370-RC, transcript variant C (CG17370), mRNA 
0   NM_143180.1  CG17370-RA, transcript variant A (CG17370), mRNA 
0   NM_170244.1  CG17370-RB, transcript variant B (CG17370), mRNA 
0   NM_169658.2  CG5166-RC, transcript variant C (Atx2), mRNA 
0   NM_142209.2  CG5166-RA, transcript variant A (Atx2), mRNA 
0   NM_169657.1  CG5166-RB, transcript variant B (Atx2), mRNA 
0   NM_135004.1  CG3355-RA, transcript variant A (CG3355), mRNA 
0   NM_164594.1  CG3355-RB, transcript variant B (CG3355), mRNA 
0   NM_001043139.1  CG11282-RC, transcript variant C (caps), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
 
DM
+- 
VM
 
VB
 
Caspase-3 signal
N
DB
 
DC
 
DM
VM
VB
 
Dcompartment   Penetrance
   

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.