National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 15010R-3 
 Symbol ago  Full Name archipelago 
 CG No CG15010  Old CG No CG15010 
 Synonyms cdc4, SCF[Ago], CG15010, DmFbw7, anon-WO0118547.345, ago, Ago 
 Accession No (Link to NCBI) NM_168072.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
 Reference
[Please submit your publication]
Zahoor MK, Poidevin M, Lecerf C, Garrido D, Montagne J.
A Drosophila genetic screen for suppressors of S6kinase-dependent growth identifies the F-box subunit Archipelago/FBXW7.
Mol. Genet. Genomics (2019) [ PubMed ID = 30656413 ] [ RRC reference ]

Dui W, Lu W, Ma J, Jiao R.
A systematic phenotypic screen of F-box genes through a tissue-specific RNAi-based approach in Drosophila.
J Genet Genomics (2012) 39(8) 397-413 [ PubMed ID = 22884096 ] [ RRC reference ]

Du J, Zhang J, Su Y, Liu M, Ospina JK, Yang S, Zhu AJ.
In vivo RNAi screen reveals neddylation genes as novel regulators of Hedgehog signaling.
PLoS ONE (2011) 6(9) e24168 [ PubMed ID = 21931660 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCCCAGCTGCTAGCAGTGAATC 
 Primer Seq. 3'
aatctagaggtaccCCTCATCATCGTCATCGTCGT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CCCAGCTgCT AGCAGTGAAT CCGTGACCAG TGCAGGGGAG CGTACTCAGT CAGCAGTCAC 
0061 CAGCTCCACC TCCACGTGGG TCAAGAGTCA GGCCTCAACC AGCCGAAAAA CAGAAGCATC 
0121 AGAAGAATCG GGATTAGGAG CAGTAGACGC AGAAGTAGGA GCCGGCAGAG AAGCCTTTGT 
0181 ATCTATGTCA ACGCTGCGGG AGGATGTGGA GGACGTGTGT GTGTCGTCAA ACTCACAACA 
0241 TGGTTTCGCC GTAGTTTTGG ACGACGAGTC CAGCACATTT GAGATTAGCT CTTCCAACTC 
0301 ACTGCCCACC AGTGCGGGGG CGGCGTCCAC AGTGGGAGTG GTGGCCGTCG ACGACAGCTC 
0361 CTCCACGGAT ACCTTGAACG GTGGTCATCC TGACTTAGGT CACCCCGCCT CATCGGAACA 
0421 CAGTCGTCAG GGCTTTTTTA ATGAGGATAA TGAAGATcCT CCGGTTGTAT GCCTTATAAA 
0481 CGACGATGAC GATGATGAGG  
 in silico PCR Fragment
0001 CCCAGCTGCT AGCAGTGAAT CCGTGACCAG TGCAGGGGAG CGTACTCAGT CAGCAGTCAC 
0061 CAGCTCCACC TCCACGTGGG TCAAGAGTCA GGCCTCAACC AGCCGAAAAA CAGAAGCATC 
0121 AGAAGAATCG GGATTAGGAG CAGTAGACGC AGAAGTAGGA GCCGGCAGAG AAGCCTTTGT 
0181 ATCTATGTCA ACGCTGCGGG AGGATGTGGA GGACGTGTGT GTGTCGTCAA ACTCACAACA 
0241 TGGTTTCGCC GTAGTTTTGG ACGACGAGTC CAGCACATTT GAGATTAGCT CTTCCAACTC 
0301 ACTGCCCACC AGTGCGGGGG CGGCGTCCAC AGTGGGAGTG GTGGCCGTCG ACGACAGCTC 
0361 CTCCACGGAT ACCTTGAACG GTGGTCATCC TGACTTAGGT CACCCCGCCT CATCGGAACA 
0421 CAGTCGTCAG GGCTTTTTTA ATGAGGATAA TGAAGATCCT CCGGTTGTAT GCCTTATAAA 
0481 CGACGATGAC GATGATGAGG  
 Assemble Data

15010R-3.IR_full       1   CCCAGCTGCTAGCAGTGAATCCGTGACCAGTGCAGGGGAGCGTACTCAGTCAGCAGTCAC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15010R-3.in silico     1   CCCAGCTGCTAGCAGTGAATCCGTGACCAGTGCAGGGGAGCGTACTCAGTCAGCAGTCAC 60


15010R-3.IR_full       61  CAGCTCCACCTCCACGTGGGTCAAGAGTCAGGCCTCAACCAGCCGAAAAACAGAAGCATC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15010R-3.in silico     61  CAGCTCCACCTCCACGTGGGTCAAGAGTCAGGCCTCAACCAGCCGAAAAACAGAAGCATC 120


15010R-3.IR_full       121 AGAAGAATCGGGATTAGGAGCAGTAGACGCAGAAGTAGGAGCCGGCAGAGAAGCCTTTGT 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15010R-3.in silico     121 AGAAGAATCGGGATTAGGAGCAGTAGACGCAGAAGTAGGAGCCGGCAGAGAAGCCTTTGT 180


15010R-3.IR_full       181 ATCTATGTCAACGCTGCGGGAGGATGTGGAGGACGTGTGTGTGTCGTCAAACTCACAACA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15010R-3.in silico     181 ATCTATGTCAACGCTGCGGGAGGATGTGGAGGACGTGTGTGTGTCGTCAAACTCACAACA 240


15010R-3.IR_full       241 TGGTTTCGCCGTAGTTTTGGACGACGAGTCCAGCACATTTGAGATTAGCTCTTCCAACTC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15010R-3.in silico     241 TGGTTTCGCCGTAGTTTTGGACGACGAGTCCAGCACATTTGAGATTAGCTCTTCCAACTC 300


15010R-3.IR_full       301 ACTGCCCACCAGTGCGGGGGCGGCGTCCACAGTGGGAGTGGTGGCCGTCGACGACAGCTC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15010R-3.in silico     301 ACTGCCCACCAGTGCGGGGGCGGCGTCCACAGTGGGAGTGGTGGCCGTCGACGACAGCTC 360


15010R-3.IR_full       361 CTCCACGGATACCTTGAACGGTGGTCATCCTGACTTAGGTCACCCCGCCTCATCGGAACA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15010R-3.in silico     361 CTCCACGGATACCTTGAACGGTGGTCATCCTGACTTAGGTCACCCCGCCTCATCGGAACA 420


15010R-3.IR_full       421 CAGTCGTCAGGGCTTTTTTAATGAGGATAATGAAGATCCTCCGGTTGTATGCCTTATAAA 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15010R-3.in silico     421 CAGTCGTCAGGGCTTTTTTAATGAGGATAATGAAGATCCTCCGGTTGTATGCCTTATAAA 480


15010R-3.IR_full       481 CGACGATGACGATGATGAGG 500
                           ||||||||||||||||||||
15010R-3.in silico     481 CGACGATGACGATGATGAGG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_079198.2  CG15010-RC, transcript variant C (ago), mRNA 
100   482  NM_168073.1  CG15010-RB, transcript variant B (ago), mRNA 
100   482  NM_168072.1  CG15010-RA, transcript variant A (ago), mRNA 
0   NM_080189.2  CG16880-RA (l(2)34Fa), mRNA 
0   19  NM_170139.1  CG31132-RA (BRWD3), mRNA 
0   NM_168771.1  CG4144-RA, transcript variant A (GNBP2), mRNA 
0   NM_168772.1  CG4144-RD, transcript variant D (GNBP2), mRNA 
0   NM_079417.2  CG4144-RB, transcript variant B (GNBP2), mRNA 
0   NM_168773.1  CG4144-RC, transcript variant C (GNBP2), mRNA 
0   11  31  NM_140110.2  CG8108-RB, transcript variant B (CG8108), mRNA 
0   11  31  NM_168386.1  CG8108-RA, transcript variant A (CG8108), mRNA 
0   12  NM_130725.2  CG15239-RA (CG15239), mRNA 
0   NM_170640.2  CG32464-RK, transcript variant K (l(3)82Fd), mRNA 
0   NM_206429.1  CG32464-RG, transcript variant G (l(3)82Fd), mRNA 
0   NM_169038.1  CG32464-RJ, transcript variant J (l(3)82Fd), mRNA 
0   NM_001031977.1  CG32464-RN, transcript variant N (l(3)82Fd), mRNA 
0   NM_001043213.1  CG32464-RP, transcript variant P (l(3)82Fd), mRNA 
0   NM_143760.2  CG32464-RB, transcript variant B (l(3)82Fd), mRNA 
0   NM_169039.2  CG32464-RL, transcript variant L (l(3)82Fd), mRNA 
0   NM_001043214.1  CG32464-RO, transcript variant O (l(3)82Fd), mRNA 
0   NM_001031978.1  CG32464-RM, transcript variant M (l(3)82Fd), mRNA 
0   NM_170641.1  CG32464-RF, transcript variant F (l(3)82Fd), mRNA 
0   NM_170644.1  CG32464-RA, transcript variant A (l(3)82Fd), mRNA 
0   NM_169045.1  CG32464-RH, transcript variant H (l(3)82Fd), mRNA 
0   NM_170643.1  CG32464-RC, transcript variant C (l(3)82Fd), mRNA 
0   NM_170642.1  CG32464-RI, transcript variant I (l(3)82Fd), mRNA 
0   NM_167218.1  CG32685-RC (CG32685), mRNA 
0   NM_142706.2  CG3308-RA (CG3308), mRNA 
0   NM_142705.1  CG5919-RA (CG5919), mRNA 
0   NM_164957.1  CG6181-RB, transcript variant B (CG6181), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.