National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 15010R-2 
 Symbol ago  Full Name archipelago 
 CG No CG15010  Old CG No CG15010 
 Synonyms cdc4, SCF[Ago], CG15010, DmFbw7, anon-WO0118547.345, ago, Ago 
 Accession No (Link to NCBI) NM_168072.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
[Please submit your publication]
Chen ZS, Wong AKY, Cheng TC, Koon AC, Chan HYE.
FipoQ/FBXO33, a Cullin-1 based ubiquitin ligase complex component modulates ubiquitination and solubility of polyglutamine disease protein.
J. Neurochem. (2019) [ PubMed ID = 30685895 ] [ RRC reference ]

Eusebio N, Tavares L, Pereira PS.
CtBP represses Dpp-dependent Mad activation during Drosophila eye development.
Dev. Biol. (2018) 442(1) 188-198 [ PubMed ID = 30031756 ] [ RRC reference ]

Zahoor MK, Poidevin M, Lecerf C, Garrido D, Montagne J.
A Drosophila genetic screen for suppressors of S6kinase-dependent growth identifies the F-box subunit Archipelago/FBXW7.
Mol. Genet. Genomics (2019) [ PubMed ID = 30656413 ] [ RRC reference ]

Dui W, Lu W, Ma J, Jiao R.
A systematic phenotypic screen of F-box genes through a tissue-specific RNAi-based approach in Drosophila.
J Genet Genomics (2012) 39(8) 397-413 [ PubMed ID = 22884096 ] [ RRC reference ]

Du J, Zhang J, Su Y, Liu M, Ospina JK, Yang S, Zhu AJ.
In vivo RNAi screen reveals neddylation genes as novel regulators of Hedgehog signaling.
PLoS ONE (2011) 6(9) e24168 [ PubMed ID = 21931660 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   CCCAGCTGCTAGCAGTGAATCCGTGACCAGTGCAGGGGAGCGTACTCAGTCAGCAGTCAC 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  CAGCTCCACCTCCACGTGGGTCAAGAGTCAGGCCTCAACCAGCCGAAAAACAGAAGCATC 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 AGAAGAATCGGGATTAGGAGCAGTAGACGCAGAAGTAGGAGCCGGCAGAGAAGCCTTTGT 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 ATCTATGTCAACGCTGCGGGAGGATGTGGAGGACGTGTGTGTGTCGTCAAACTCACAACA 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 TGGTTTCGCCGTAGTTTTGGACGACGAGTCCAGCACATTTGAGATTAGCTCTTCCAACTC 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 ACTGCCCACCAGTGCGGGGGCGGCGTCCACAGTGGGAGTGGTGGCCGTCGACGACAGCTC 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 CTCCACGGATACCTTGAACGGTGGTCATCCTGACTTAGGTCACCCCGCCTCATCGGAACA 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 CAGTCGTCAGGGCTTTTTTAATGAGGATAATGAAGATCCTCCGGTTGTATGCCTTATAAA 480

15010R-2.IR_full       481 CGACGATGACGATGATGAGG 500
                           |||||||||||||||||||| silico     481 CGACGATGACGATGATGAGG 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_079198.2  CG15010-RC, transcript variant C (ago), mRNA 
100   482  NM_168073.1  CG15010-RB, transcript variant B (ago), mRNA 
100   482  NM_168072.1  CG15010-RA, transcript variant A (ago), mRNA 
0   NM_080189.2  CG16880-RA (l(2)34Fa), mRNA 
0   19  NM_170139.1  CG31132-RA (BRWD3), mRNA 
0   NM_168771.1  CG4144-RA, transcript variant A (GNBP2), mRNA 
0   NM_168772.1  CG4144-RD, transcript variant D (GNBP2), mRNA 
0   NM_079417.2  CG4144-RB, transcript variant B (GNBP2), mRNA 
0   NM_168773.1  CG4144-RC, transcript variant C (GNBP2), mRNA 
0   11  31  NM_140110.2  CG8108-RB, transcript variant B (CG8108), mRNA 
0   11  31  NM_168386.1  CG8108-RA, transcript variant A (CG8108), mRNA 
0   12  NM_130725.2  CG15239-RA (CG15239), mRNA 
0   NM_170640.2  CG32464-RK, transcript variant K (l(3)82Fd), mRNA 
0   NM_206429.1  CG32464-RG, transcript variant G (l(3)82Fd), mRNA 
0   NM_169038.1  CG32464-RJ, transcript variant J (l(3)82Fd), mRNA 
0   NM_001031977.1  CG32464-RN, transcript variant N (l(3)82Fd), mRNA 
0   NM_001043213.1  CG32464-RP, transcript variant P (l(3)82Fd), mRNA 
0   NM_143760.2  CG32464-RB, transcript variant B (l(3)82Fd), mRNA 
0   NM_169039.2  CG32464-RL, transcript variant L (l(3)82Fd), mRNA 
0   NM_001043214.1  CG32464-RO, transcript variant O (l(3)82Fd), mRNA 
0   NM_001031978.1  CG32464-RM, transcript variant M (l(3)82Fd), mRNA 
0   NM_170641.1  CG32464-RF, transcript variant F (l(3)82Fd), mRNA 
0   NM_170644.1  CG32464-RA, transcript variant A (l(3)82Fd), mRNA 
0   NM_169045.1  CG32464-RH, transcript variant H (l(3)82Fd), mRNA 
0   NM_170643.1  CG32464-RC, transcript variant C (l(3)82Fd), mRNA 
0   NM_170642.1  CG32464-RI, transcript variant I (l(3)82Fd), mRNA 
0   NM_167218.1  CG32685-RC (CG32685), mRNA 
0   NM_142706.2  CG3308-RA (CG3308), mRNA 
0   NM_142705.1  CG5919-RA (CG5919), mRNA 
0   NM_164957.1  CG6181-RB, transcript variant B (CG6181), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.