National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1497R-3 
 Symbol CG32523  Full Name CG32523 
 CG No CG32523  Old CG No CG1497 
 Synonyms CG1497, SP50, CG32523 
 Accession No (Link to NCBI) NM_167738.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGGGACAGGACGTAGCCCAAAA 
 Primer Seq. 3'
aatctagaggtaccCCCCCCTCGATATACTCGTCA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GGGACAGGAC GTAGCCCAAA ATCAGAGTGA ATCCGCGATA GAGCCTCGAA TCGTTGGCGG 
0061 AATCAAGGCG AAGCAGGGCC AATTTCCGCA CCAGATTTCC CTGCGTCTAC GTGGAGAACA 
0121 CTACTGCGGT GGAGTCATAA TCTCGGCCAC TCACGTAATC ACCGCTGGCC ACTGTGTGAA 
0181 GCACGGGAAT GATGTAGTTC CGGCAGATCT ATGGTCAATC CAGGCGGGCA GTCTGCTCCT 
0241 CTCAAGCGAC GGAGTGAGGA TTCCAGTGGC CGAAGTTATC ATGCATCCCA ACTATGCCAC 
0301 TGGTGGACAC AACGATTTGG CCGTGCTCCG ACTGCAGAGT CCGCTGACCT TTGACGCCAA 
0361 CATAGCCGCC ATCCAGTTGG CCACCGAGGA TCCGCCCAAC TGTGTCGCCG TAGACATCTC 
0421 CGGTTGGGGC AACATTGCGG AGAAGGGACC CCTCTCTGAC AGCCTGTTAT TCGTACAGGT 
0481 GACGAGTATA TCGAGGGGGG  
 in silico PCR Fragment
0001 GGGACAGGAC GTAGCCCAAA ATCAGAGTGA ATCCGCGATA GAGCCTCGAA TCGTTGGCGG 
0061 AATCAAGGCG AAGCAGGGCC AATTTCCGCA CCAGATTTCC CTGCGTCTAC GTGGAGAACA 
0121 CTACTGCGGT GGAGTCATAA TCTCGGCCAC TCACGTAATC ACCGCTGGCC ACTGTGTGAA 
0181 GCACGGGAAT GATGTAGTTC CGGCAGATCT ATGGTCAATC CAGGCGGGCA GTCTGCTCCT 
0241 CTCAAGCGAC GGAGTGAGGA TTCCAGTGGC CGAAGTTATC ATGCATCCCA ACTATGCCAC 
0301 TGGTGGACAC AACGATTTGG CCGTGCTCCG ACTGCAGAGT CCGCTGACCT TTGACGCCAA 
0361 CATAGCCGCC ATCCAGTTGG CCACCGAGGA TCCGCCCAAC TGTGTCGCCG TAGACATCTC 
0421 CGGTTGGGGC AACATTGCGG AGAAGGGACC CCTCTCTGAC AGCCTGTTAT TCGTACAGGT 
0481 GACGAGTATA TCGAGGGGGG  
 Assemble Data

1497R-3.IR_full       1   GGGACAGGACGTAGCCCAAAATCAGAGTGAATCCGCGATAGAGCCTCGAATCGTTGGCGG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1497R-3.in silico     1   GGGACAGGACGTAGCCCAAAATCAGAGTGAATCCGCGATAGAGCCTCGAATCGTTGGCGG 60


1497R-3.IR_full       61  AATCAAGGCGAAGCAGGGCCAATTTCCGCACCAGATTTCCCTGCGTCTACGTGGAGAACA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1497R-3.in silico     61  AATCAAGGCGAAGCAGGGCCAATTTCCGCACCAGATTTCCCTGCGTCTACGTGGAGAACA 120


1497R-3.IR_full       121 CTACTGCGGTGGAGTCATAATCTCGGCCACTCACGTAATCACCGCTGGCCACTGTGTGAA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1497R-3.in silico     121 CTACTGCGGTGGAGTCATAATCTCGGCCACTCACGTAATCACCGCTGGCCACTGTGTGAA 180


1497R-3.IR_full       181 GCACGGGAATGATGTAGTTCCGGCAGATCTATGGTCAATCCAGGCGGGCAGTCTGCTCCT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1497R-3.in silico     181 GCACGGGAATGATGTAGTTCCGGCAGATCTATGGTCAATCCAGGCGGGCAGTCTGCTCCT 240


1497R-3.IR_full       241 CTCAAGCGACGGAGTGAGGATTCCAGTGGCCGAAGTTATCATGCATCCCAACTATGCCAC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1497R-3.in silico     241 CTCAAGCGACGGAGTGAGGATTCCAGTGGCCGAAGTTATCATGCATCCCAACTATGCCAC 300


1497R-3.IR_full       301 TGGTGGACACAACGATTTGGCCGTGCTCCGACTGCAGAGTCCGCTGACCTTTGACGCCAA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1497R-3.in silico     301 TGGTGGACACAACGATTTGGCCGTGCTCCGACTGCAGAGTCCGCTGACCTTTGACGCCAA 360


1497R-3.IR_full       361 CATAGCCGCCATCCAGTTGGCCACCGAGGATCCGCCCAACTGTGTCGCCGTAGACATCTC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1497R-3.in silico     361 CATAGCCGCCATCCAGTTGGCCACCGAGGATCCGCCCAACTGTGTCGCCGTAGACATCTC 420


1497R-3.IR_full       421 CGGTTGGGGCAACATTGCGGAGAAGGGACCCCTCTCTGACAGCCTGTTATTCGTACAGGT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1497R-3.in silico     421 CGGTTGGGGCAACATTGCGGAGAAGGGACCCCTCTCTGACAGCCTGTTATTCGTACAGGT 480


1497R-3.IR_full       481 GACGAGTATATCGAGGGGGG 500
                          ||||||||||||||||||||
1497R-3.in silico     481 GACGAGTATATCGAGGGGGG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.